Incidental Mutation 'R6299:Olfr659'
ID508971
Institutional Source Beutler Lab
Gene Symbol Olfr659
Ensembl Gene ENSMUSG00000073922
Gene Nameolfactory receptor 659
SynonymsGA_x6K02T2PBJ9-7298889-7299857, MOR34-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104666753-104674948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104670868 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 55 (D55E)
Ref Sequence ENSEMBL: ENSMUSP00000149939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098170] [ENSMUST00000214986]
Predicted Effect probably benign
Transcript: ENSMUST00000098170
AA Change: D55E

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095772
Gene: ENSMUSG00000073922
AA Change: D55E

DomainStartEndE-ValueType
Pfam:7tm_4 33 314 5.2e-99 PFAM
Pfam:7TM_GPCR_Srsx 37 256 7.2e-9 PFAM
Pfam:7tm_1 43 296 4.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214986
AA Change: D55E

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Olfr659
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Olfr659 APN 7 104671071 missense probably damaging 1.00
IGL01640:Olfr659 APN 7 104671664 missense probably damaging 0.96
IGL01774:Olfr659 APN 7 104670942 missense probably benign 0.01
IGL01912:Olfr659 APN 7 104671233 missense possibly damaging 0.91
IGL02338:Olfr659 APN 7 104671681 utr 3 prime probably benign
IGL02611:Olfr659 APN 7 104671407 missense possibly damaging 0.91
IGL02707:Olfr659 APN 7 104670929 missense probably damaging 0.97
R1139:Olfr659 UTSW 7 104670891 missense probably damaging 1.00
R1283:Olfr659 UTSW 7 104670943 missense possibly damaging 0.94
R1867:Olfr659 UTSW 7 104671317 missense possibly damaging 0.89
R2004:Olfr659 UTSW 7 104671601 missense possibly damaging 0.88
R2265:Olfr659 UTSW 7 104670860 missense probably benign 0.00
R4057:Olfr659 UTSW 7 104671269 missense probably damaging 1.00
R4519:Olfr659 UTSW 7 104670839 missense probably damaging 1.00
R4735:Olfr659 UTSW 7 104670993 missense probably benign
R4745:Olfr659 UTSW 7 104671504 missense probably damaging 1.00
R4816:Olfr659 UTSW 7 104670735 missense probably benign 0.04
R5274:Olfr659 UTSW 7 104671526 missense probably damaging 0.99
R6312:Olfr659 UTSW 7 104671589 missense probably damaging 1.00
R6770:Olfr659 UTSW 7 104671518 missense probably damaging 1.00
R7293:Olfr659 UTSW 7 104670718 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGGTTGGACAGTCATGC -3'
(R):5'- CATCGCTGTGAAAGTATGGATGAAG -3'

Sequencing Primer
(F):5'- TAGCCACTTTAGATGATGCCAGC -3'
(R):5'- TGAAGAACATCTGGACCAGAC -3'
Posted On2018-04-02