Incidental Mutation 'R6299:Srcap'
ID508972
Institutional Source Beutler Lab
Gene Symbol Srcap
Ensembl Gene ENSMUSG00000053877
Gene NameSnf2-related CREBBP activator protein
SynonymsD030022P06Rik, F630004O05Rik, B930091H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127511983-127561219 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 127530454 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066582] [ENSMUST00000186672] [ENSMUST00000186954] [ENSMUST00000187040] [ENSMUST00000188124] [ENSMUST00000189629] [ENSMUST00000190390]
Predicted Effect unknown
Transcript: ENSMUST00000066582
AA Change: C483R
SMART Domains Protein: ENSMUSP00000063817
Gene: ENSMUSG00000053877
AA Change: C483R

DomainStartEndE-ValueType
Pfam:HSA 108 177 1.1e-22 PFAM
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 460 538 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
DEXDc 606 798 1.22e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185401
Predicted Effect unknown
Transcript: ENSMUST00000186672
AA Change: C503R
SMART Domains Protein: ENSMUSP00000140395
Gene: ENSMUSG00000053877
AA Change: C503R

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186954
AA Change: C503R
SMART Domains Protein: ENSMUSP00000139536
Gene: ENSMUSG00000053877
AA Change: C503R

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1175 1194 N/A INTRINSIC
internal_repeat_1 1202 1245 2.24e-5 PROSPERO
low complexity region 1274 1302 N/A INTRINSIC
low complexity region 1304 1318 N/A INTRINSIC
low complexity region 1335 1353 N/A INTRINSIC
low complexity region 1355 1370 N/A INTRINSIC
low complexity region 1414 1441 N/A INTRINSIC
low complexity region 1452 1466 N/A INTRINSIC
low complexity region 1504 1533 N/A INTRINSIC
internal_repeat_1 1536 1579 2.24e-5 PROSPERO
internal_repeat_2 1537 1559 5.66e-5 PROSPERO
internal_repeat_2 1569 1589 5.66e-5 PROSPERO
low complexity region 1590 1607 N/A INTRINSIC
low complexity region 1609 1627 N/A INTRINSIC
low complexity region 1644 1678 N/A INTRINSIC
low complexity region 1713 1726 N/A INTRINSIC
low complexity region 1828 1840 N/A INTRINSIC
HELICc 1916 1999 1.2e-28 SMART
low complexity region 2058 2078 N/A INTRINSIC
coiled coil region 2166 2201 N/A INTRINSIC
low complexity region 2282 2348 N/A INTRINSIC
low complexity region 2374 2409 N/A INTRINSIC
low complexity region 2588 2600 N/A INTRINSIC
low complexity region 2642 2657 N/A INTRINSIC
low complexity region 2685 2712 N/A INTRINSIC
AT_hook 2745 2757 2.4e-2 SMART
low complexity region 2797 2817 N/A INTRINSIC
AT_hook 2825 2837 2.6e-3 SMART
low complexity region 2838 2849 N/A INTRINSIC
low complexity region 2858 2885 N/A INTRINSIC
AT_hook 2889 2901 2.4e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2946 2956 N/A INTRINSIC
low complexity region 3043 3079 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187040
AA Change: C503R
SMART Domains Protein: ENSMUSP00000140036
Gene: ENSMUSG00000053877
AA Change: C503R

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1277 1305 N/A INTRINSIC
low complexity region 1332 1351 N/A INTRINSIC
internal_repeat_1 1359 1402 1.78e-5 PROSPERO
low complexity region 1431 1459 N/A INTRINSIC
low complexity region 1461 1475 N/A INTRINSIC
low complexity region 1492 1510 N/A INTRINSIC
low complexity region 1512 1527 N/A INTRINSIC
low complexity region 1571 1598 N/A INTRINSIC
low complexity region 1609 1623 N/A INTRINSIC
low complexity region 1661 1690 N/A INTRINSIC
internal_repeat_1 1693 1736 1.78e-5 PROSPERO
internal_repeat_2 1694 1716 4.56e-5 PROSPERO
internal_repeat_2 1726 1746 4.56e-5 PROSPERO
low complexity region 1747 1764 N/A INTRINSIC
low complexity region 1766 1784 N/A INTRINSIC
low complexity region 1801 1835 N/A INTRINSIC
low complexity region 1870 1883 N/A INTRINSIC
low complexity region 1985 1997 N/A INTRINSIC
HELICc 2073 2156 1.2e-28 SMART
low complexity region 2215 2235 N/A INTRINSIC
coiled coil region 2323 2358 N/A INTRINSIC
low complexity region 2439 2505 N/A INTRINSIC
low complexity region 2531 2566 N/A INTRINSIC
low complexity region 2745 2757 N/A INTRINSIC
low complexity region 2799 2814 N/A INTRINSIC
low complexity region 2842 2869 N/A INTRINSIC
AT_hook 2902 2914 2.4e-2 SMART
low complexity region 2954 2974 N/A INTRINSIC
AT_hook 2982 2994 2.6e-3 SMART
low complexity region 2995 3006 N/A INTRINSIC
low complexity region 3015 3042 N/A INTRINSIC
AT_hook 3046 3058 2.4e-3 SMART
low complexity region 3091 3102 N/A INTRINSIC
low complexity region 3103 3113 N/A INTRINSIC
low complexity region 3200 3236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187164
Predicted Effect probably benign
Transcript: ENSMUST00000188124
SMART Domains Protein: ENSMUSP00000140882
Gene: ENSMUSG00000053877

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189629
AA Change: C484R
SMART Domains Protein: ENSMUSP00000139644
Gene: ENSMUSG00000107023
AA Change: C484R

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
HSA 106 177 5.4e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 401 N/A INTRINSIC
low complexity region 461 539 N/A INTRINSIC
low complexity region 558 573 N/A INTRINSIC
DEXDc 607 799 5e-37 SMART
low complexity region 974 982 N/A INTRINSIC
low complexity region 1008 1023 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
low complexity region 1156 1175 N/A INTRINSIC
internal_repeat_1 1183 1226 2e-5 PROSPERO
low complexity region 1255 1283 N/A INTRINSIC
low complexity region 1285 1299 N/A INTRINSIC
low complexity region 1316 1334 N/A INTRINSIC
low complexity region 1336 1351 N/A INTRINSIC
low complexity region 1395 1422 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
low complexity region 1485 1514 N/A INTRINSIC
internal_repeat_1 1517 1560 2e-5 PROSPERO
internal_repeat_2 1518 1540 5.08e-5 PROSPERO
internal_repeat_2 1550 1570 5.08e-5 PROSPERO
low complexity region 1571 1588 N/A INTRINSIC
low complexity region 1590 1608 N/A INTRINSIC
low complexity region 1625 1659 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
low complexity region 1809 1821 N/A INTRINSIC
HELICc 1897 1980 1.2e-28 SMART
low complexity region 2039 2059 N/A INTRINSIC
coiled coil region 2147 2182 N/A INTRINSIC
low complexity region 2263 2329 N/A INTRINSIC
low complexity region 2355 2390 N/A INTRINSIC
low complexity region 2569 2581 N/A INTRINSIC
low complexity region 2623 2638 N/A INTRINSIC
low complexity region 2666 2693 N/A INTRINSIC
AT_hook 2726 2738 2.4e-2 SMART
low complexity region 2778 2798 N/A INTRINSIC
AT_hook 2806 2818 2.6e-3 SMART
low complexity region 2819 2830 N/A INTRINSIC
low complexity region 2839 2866 N/A INTRINSIC
AT_hook 2870 2882 2.4e-3 SMART
low complexity region 2915 2926 N/A INTRINSIC
low complexity region 2927 2937 N/A INTRINSIC
low complexity region 3024 3060 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189812
Predicted Effect unknown
Transcript: ENSMUST00000190390
AA Change: C503R
SMART Domains Protein: ENSMUSP00000139399
Gene: ENSMUSG00000053877
AA Change: C503R

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1271 1290 N/A INTRINSIC
internal_repeat_1 1298 1341 2.01e-5 PROSPERO
low complexity region 1370 1398 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1431 1449 N/A INTRINSIC
low complexity region 1451 1466 N/A INTRINSIC
low complexity region 1510 1537 N/A INTRINSIC
low complexity region 1548 1562 N/A INTRINSIC
low complexity region 1600 1629 N/A INTRINSIC
internal_repeat_1 1632 1675 2.01e-5 PROSPERO
internal_repeat_2 1633 1655 5.11e-5 PROSPERO
internal_repeat_2 1665 1685 5.11e-5 PROSPERO
low complexity region 1686 1703 N/A INTRINSIC
low complexity region 1705 1723 N/A INTRINSIC
low complexity region 1740 1774 N/A INTRINSIC
low complexity region 1809 1822 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
HELICc 2012 2095 1.2e-28 SMART
low complexity region 2154 2174 N/A INTRINSIC
coiled coil region 2262 2297 N/A INTRINSIC
low complexity region 2378 2444 N/A INTRINSIC
low complexity region 2470 2505 N/A INTRINSIC
low complexity region 2684 2696 N/A INTRINSIC
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2781 2808 N/A INTRINSIC
AT_hook 2841 2853 2.4e-2 SMART
low complexity region 2893 2913 N/A INTRINSIC
AT_hook 2921 2933 2.6e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2954 2981 N/A INTRINSIC
AT_hook 2985 2997 2.4e-3 SMART
low complexity region 3030 3041 N/A INTRINSIC
low complexity region 3042 3052 N/A INTRINSIC
low complexity region 3139 3175 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated, CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome, a rare disorder characterized by short stature, language deficits and dysmorphic facial features. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Srcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Srcap APN 7 127542713 splice site probably benign
IGL00475:Srcap APN 7 127552921 missense possibly damaging 0.92
IGL01064:Srcap APN 7 127559892 unclassified probably benign
IGL01129:Srcap APN 7 127521651 missense probably damaging 1.00
IGL01670:Srcap APN 7 127528432 missense probably damaging 1.00
IGL01861:Srcap APN 7 127525285 splice site probably benign
IGL02237:Srcap APN 7 127534692 splice site probably benign
IGL02665:Srcap APN 7 127540903 missense probably damaging 1.00
IGL02688:Srcap APN 7 127542453 missense probably benign 0.04
IGL02744:Srcap APN 7 127534666 missense probably damaging 1.00
IGL02810:Srcap APN 7 127521663 critical splice donor site probably null
IGL03184:Srcap APN 7 127530502 unclassified probably benign
IGL03309:Srcap APN 7 127530793 missense probably damaging 0.99
PIT4453001:Srcap UTSW 7 127549320 missense possibly damaging 0.52
R1340:Srcap UTSW 7 127560738 intron probably benign
R1401:Srcap UTSW 7 127559952 unclassified probably benign
R1455:Srcap UTSW 7 127530650 missense probably damaging 0.99
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1761:Srcap UTSW 7 127534845 missense probably damaging 1.00
R1911:Srcap UTSW 7 127534822 missense probably damaging 0.99
R2483:Srcap UTSW 7 127542147 missense probably damaging 0.99
R2892:Srcap UTSW 7 127539065 missense probably damaging 0.99
R2893:Srcap UTSW 7 127539065 missense probably damaging 0.99
R3623:Srcap UTSW 7 127542147 missense probably damaging 0.99
R3976:Srcap UTSW 7 127549239 missense probably benign 0.18
R4001:Srcap UTSW 7 127532167 missense probably damaging 1.00
R4015:Srcap UTSW 7 127525423 missense probably benign 0.27
R4581:Srcap UTSW 7 127558310 unclassified probably benign
R4643:Srcap UTSW 7 127541776 missense probably damaging 1.00
R4644:Srcap UTSW 7 127552598 missense probably damaging 1.00
R4690:Srcap UTSW 7 127538014 missense probably damaging 1.00
R4693:Srcap UTSW 7 127538544 missense probably damaging 1.00
R4719:Srcap UTSW 7 127541559 missense probably benign 0.13
R4728:Srcap UTSW 7 127540924 critical splice donor site probably null
R4740:Srcap UTSW 7 127549299 missense probably damaging 1.00
R4752:Srcap UTSW 7 127559000 unclassified probably benign
R4834:Srcap UTSW 7 127557610 critical splice donor site probably null
R4837:Srcap UTSW 7 127558962 unclassified probably benign
R4884:Srcap UTSW 7 127522017 missense probably damaging 1.00
R4889:Srcap UTSW 7 127538547 missense possibly damaging 0.94
R5088:Srcap UTSW 7 127541661 missense probably benign 0.02
R5102:Srcap UTSW 7 127530623 missense probably damaging 1.00
R5358:Srcap UTSW 7 127540320 missense probably damaging 1.00
R5372:Srcap UTSW 7 127557613 splice site probably null
R5397:Srcap UTSW 7 127553296 critical splice donor site probably null
R5481:Srcap UTSW 7 127532197 missense probably damaging 1.00
R5566:Srcap UTSW 7 127525303 missense probably damaging 0.99
R5584:Srcap UTSW 7 127528479 missense probably damaging 1.00
R5693:Srcap UTSW 7 127519816 missense probably damaging 1.00
R5769:Srcap UTSW 7 127559822 unclassified probably benign
R5805:Srcap UTSW 7 127542039 missense possibly damaging 0.87
R5806:Srcap UTSW 7 127559163 unclassified probably benign
R5921:Srcap UTSW 7 127558833 unclassified probably benign
R5942:Srcap UTSW 7 127538008 missense probably damaging 1.00
R6014:Srcap UTSW 7 127538750 missense probably benign 0.01
R6057:Srcap UTSW 7 127541356 missense probably damaging 0.99
R6113:Srcap UTSW 7 127560281 unclassified probably benign
R6150:Srcap UTSW 7 127534828 missense probably damaging 1.00
R6212:Srcap UTSW 7 127549689 missense probably damaging 1.00
R6437:Srcap UTSW 7 127528550 intron probably null
R6492:Srcap UTSW 7 127522145 nonsense probably null
R6537:Srcap UTSW 7 127542220 missense probably damaging 0.97
R6659:Srcap UTSW 7 127542391 missense probably damaging 1.00
R6713:Srcap UTSW 7 127534917 missense probably benign 0.28
R6717:Srcap UTSW 7 127558310 unclassified probably benign
R6941:Srcap UTSW 7 127542597 missense probably damaging 1.00
R7068:Srcap UTSW 7 127541943 missense probably benign 0.00
R7097:Srcap UTSW 7 127539041 missense probably damaging 1.00
R7394:Srcap UTSW 7 127534828 missense probably damaging 1.00
R7426:Srcap UTSW 7 127538517 missense possibly damaging 0.90
R7434:Srcap UTSW 7 127560242 missense unknown
R7559:Srcap UTSW 7 127530550 missense unknown
R7638:Srcap UTSW 7 127538748 missense probably benign 0.39
R7677:Srcap UTSW 7 127559808 missense unknown
R7715:Srcap UTSW 7 127549288 missense probably damaging 0.99
R7757:Srcap UTSW 7 127530794 missense probably damaging 0.99
R7811:Srcap UTSW 7 127542049 missense probably damaging 0.97
R7821:Srcap UTSW 7 127530327 unclassified probably benign
X0025:Srcap UTSW 7 127560105 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TATGCCTGTGATGCCTCTGC -3'
(R):5'- GGGCAAGCAAGTACTCTACTC -3'

Sequencing Primer
(F):5'- TCCAGCCTCAGGGGATAGTG -3'
(R):5'- TCTACTCCAAAACCATCATCATCGTC -3'
Posted On2018-04-02