Incidental Mutation 'R6299:Trmt1'
ID508976
Institutional Source Beutler Lab
Gene Symbol Trmt1
Ensembl Gene ENSMUSG00000001909
Gene NametRNA methyltransferase 1
SynonymsD8Ertd812e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84686307-84699808 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 84697290 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 36 (C36*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000037165] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370] [ENSMUST00000131700] [ENSMUST00000143427] [ENSMUST00000152301] [ENSMUST00000175784] [ENSMUST00000177084] [ENSMUST00000177423]
Predicted Effect probably null
Transcript: ENSMUST00000001974
AA Change: C375*
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909
AA Change: C375*

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037165
SMART Domains Protein: ENSMUSP00000046010
Gene: ENSMUSG00000034041

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
HLH 155 207 3.97e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109767
AA Change: C375*
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909
AA Change: C375*

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109768
AA Change: C368*
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909
AA Change: C368*

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125370
AA Change: C346*
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909
AA Change: C346*

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128022
Predicted Effect probably benign
Transcript: ENSMUST00000131700
SMART Domains Protein: ENSMUSP00000122526
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 108 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136423
SMART Domains Protein: ENSMUSP00000134723
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138300
Predicted Effect probably benign
Transcript: ENSMUST00000143427
SMART Domains Protein: ENSMUSP00000117140
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 47 98 3.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148644
Predicted Effect probably benign
Transcript: ENSMUST00000152301
SMART Domains Protein: ENSMUSP00000116712
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 242 4.2e-49 PFAM
Pfam:Met_10 145 229 2.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175767
Predicted Effect probably benign
Transcript: ENSMUST00000175784
SMART Domains Protein: ENSMUSP00000135273
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 221 8.6e-39 PFAM
Pfam:Met_10 144 221 5.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175884
AA Change: C36*
Predicted Effect probably benign
Transcript: ENSMUST00000177084
SMART Domains Protein: ENSMUSP00000135675
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 29 260 4.1e-76 PFAM
Pfam:Met_10 117 231 4.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177286
Predicted Effect probably benign
Transcript: ENSMUST00000177423
SMART Domains Protein: ENSMUSP00000135327
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 47 262 1.4e-66 PFAM
Pfam:Met_10 138 252 5.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Trmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Trmt1 APN 8 84695509 missense possibly damaging 0.92
IGL01959:Trmt1 APN 8 84691376 unclassified probably null
IGL02127:Trmt1 APN 8 84697471 missense probably damaging 1.00
IGL02689:Trmt1 APN 8 84699756 unclassified probably benign
IGL03087:Trmt1 APN 8 84695233 missense probably damaging 1.00
IGL02835:Trmt1 UTSW 8 84696960 missense probably null 1.00
PIT4418001:Trmt1 UTSW 8 84697670 missense probably damaging 0.97
R0395:Trmt1 UTSW 8 84697112 splice site probably null
R0964:Trmt1 UTSW 8 84696852 missense probably damaging 1.00
R1881:Trmt1 UTSW 8 84689267 intron probably benign
R2190:Trmt1 UTSW 8 84689841 nonsense probably null
R2197:Trmt1 UTSW 8 84690858 missense probably damaging 1.00
R2979:Trmt1 UTSW 8 84696882 missense probably damaging 1.00
R3813:Trmt1 UTSW 8 84695217 unclassified probably benign
R4407:Trmt1 UTSW 8 84697755 unclassified probably benign
R4461:Trmt1 UTSW 8 84699149 missense probably benign 0.01
R4588:Trmt1 UTSW 8 84690753 intron probably benign
R5170:Trmt1 UTSW 8 84695232 missense probably damaging 1.00
R6614:Trmt1 UTSW 8 84689333 missense probably benign
R6666:Trmt1 UTSW 8 84698454 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTGACCATATCAGGGACTC -3'
(R):5'- CCCACAAAGTCCAGGTCATG -3'

Sequencing Primer
(F):5'- GTGACCATATCAGGGACTCATGATC -3'
(R):5'- CAGGTCATGGATGGGCTC -3'
Posted On2018-04-02