Incidental Mutation 'R6299:Map2k1'
ID508979
Institutional Source Beutler Lab
Gene Symbol Map2k1
Ensembl Gene ENSMUSG00000004936
Gene Namemitogen-activated protein kinase kinase 1
SynonymsMek1, MAP kinase kinase 1, Prkmk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64185770-64253631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64214490 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 67 (D67G)
Ref Sequence ENSEMBL: ENSMUSP00000005066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005066
AA Change: D67G

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936
AA Change: D67G

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Meta Mutation Damage Score 0.5154 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein kinase lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, this kinase is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced embryo size and midgestational lethality due to impaired development and hypovascularization of the placenta with decreased labyrinth cell proliferation and enhanced cell apoptosis. Mutant MEFs fail to exhibit fibronectin-induced migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Map2k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Map2k1 APN 9 64193808 missense probably benign 0.39
mystic_falls UTSW 9 64191266 critical splice donor site probably null
R0366:Map2k1 UTSW 9 64193702 splice site probably null
R4285:Map2k1 UTSW 9 64212643 missense probably damaging 0.99
R5254:Map2k1 UTSW 9 64187745 unclassified probably benign
R5261:Map2k1 UTSW 9 64191561 missense probably damaging 1.00
R5741:Map2k1 UTSW 9 64214601 missense possibly damaging 0.89
R5742:Map2k1 UTSW 9 64193771 missense probably damaging 0.99
R5865:Map2k1 UTSW 9 64191266 critical splice donor site probably null
R6212:Map2k1 UTSW 9 64205163 missense probably damaging 1.00
R6460:Map2k1 UTSW 9 64187295 missense probably damaging 0.97
R6843:Map2k1 UTSW 9 64187691 missense probably damaging 0.99
R7028:Map2k1 UTSW 9 64193823 missense probably benign 0.36
R7115:Map2k1 UTSW 9 64212606 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCATCAGTCACTAGAACTGG -3'
(R):5'- GGCGTTACCTTCCTTGAGTC -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- TTGGCCCAGGAGTGCAC -3'
Posted On2018-04-02