Incidental Mutation 'R6299:Dcstamp'
ID508996
Institutional Source Beutler Lab
Gene Symbol Dcstamp
Ensembl Gene ENSMUSG00000022303
Gene Namedendrocyte expressed seven transmembrane protein
SynonymsTm7sf4, 4833414I07Rik, DC-STAMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location39745930-39760938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39755203 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 336 (V336D)
Ref Sequence ENSEMBL: ENSMUSP00000154362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022913] [ENSMUST00000227368] [ENSMUST00000227792] [ENSMUST00000228556] [ENSMUST00000228701]
Predicted Effect probably damaging
Transcript: ENSMUST00000022913
AA Change: V336D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022913
Gene: ENSMUSG00000022303
AA Change: V336D

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 58 75 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Pfam:DC_STAMP 242 421 1e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227368
AA Change: V336D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227792
AA Change: V336D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228556
AA Change: V336D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228701
Meta Mutation Damage Score 0.6238 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Targeted disruption of this gene causes complete loss of osteoclast and macrophage cell fusion and leads to reduced bone-resorbing activity and mild osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Dcstamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Dcstamp APN 15 39754416 missense probably benign 0.05
IGL01963:Dcstamp APN 15 39760359 missense possibly damaging 0.82
IGL02132:Dcstamp APN 15 39754532 missense probably damaging 0.97
IGL02139:Dcstamp APN 15 39754458 missense probably damaging 1.00
IGL02607:Dcstamp APN 15 39754584 missense possibly damaging 0.94
IGL03003:Dcstamp APN 15 39754510 missense possibly damaging 0.64
IGL03061:Dcstamp APN 15 39760397 missense possibly damaging 0.81
IGL03191:Dcstamp APN 15 39754224 missense probably benign 0.00
R1144:Dcstamp UTSW 15 39760368 missense possibly damaging 0.94
R1186:Dcstamp UTSW 15 39754629 unclassified probably null
R1663:Dcstamp UTSW 15 39754944 nonsense probably null
R2117:Dcstamp UTSW 15 39755175 nonsense probably null
R2202:Dcstamp UTSW 15 39754312 missense probably damaging 0.99
R4484:Dcstamp UTSW 15 39754224 missense probably benign 0.00
R4642:Dcstamp UTSW 15 39754722 missense probably benign 0.01
R5384:Dcstamp UTSW 15 39759319 missense probably damaging 0.99
R5529:Dcstamp UTSW 15 39754536 missense probably benign 0.04
R5558:Dcstamp UTSW 15 39759540 missense probably damaging 1.00
R5562:Dcstamp UTSW 15 39754402 missense possibly damaging 0.88
R6261:Dcstamp UTSW 15 39754735 missense possibly damaging 0.65
R6377:Dcstamp UTSW 15 39754921 missense probably benign 0.01
R6566:Dcstamp UTSW 15 39754336 missense possibly damaging 0.54
R6596:Dcstamp UTSW 15 39754209 missense possibly damaging 0.95
R6869:Dcstamp UTSW 15 39754458 missense probably damaging 1.00
R7030:Dcstamp UTSW 15 39759533 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTGGAAGTATGAGAATGTCTAC -3'
(R):5'- ACTCTGGGACCTAATTTAGCCC -3'

Sequencing Primer
(F):5'- TGTGTCCTCCCGCTGAATAAGAAG -3'
(R):5'- GCCCATAATATTGGAATCCTTCTGGG -3'
Posted On2018-04-02