Incidental Mutation 'R6300:Slc19a2'
ID509006
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Namesolute carrier family 19 (thiamine transporter), member 2
SynonymsTRMA, DDA1, THTR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6300 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location164249046-164265385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164256775 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 78 (T78M)
Ref Sequence ENSEMBL: ENSMUSP00000123870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
Predicted Effect probably damaging
Transcript: ENSMUST00000044021
AA Change: T78M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: T78M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159230
AA Change: T78M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: T78M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169394
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,993,461 T185A possibly damaging Het
4932414N04Rik A G 2: 68,731,109 Y260C possibly damaging Het
Adamtsl1 G A 4: 86,248,017 G395S probably damaging Het
Amn T C 12: 111,274,189 L85P probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apip C T 2: 103,087,153 R66C possibly damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Apol6 A T 15: 77,051,271 I247L probably benign Het
Arfgap2 A G 2: 91,267,195 Q112R probably benign Het
Armh1 A G 4: 117,231,782 Y139H probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cct2 C T 10: 117,056,159 G328D probably damaging Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cers5 G T 15: 99,772,219 A54E probably damaging Het
Ctdp1 T A 18: 80,459,240 M152L probably benign Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Defb36 T A 2: 152,612,498 W26R probably damaging Het
Dnah17 T C 11: 118,034,310 E3899G probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Duox1 T G 2: 122,337,700 L1102R probably damaging Het
Dzip3 A G 16: 48,951,807 S500P probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Hoxd3 A G 2: 74,744,076 Y22C probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il6ra A G 3: 89,887,129 V175A probably damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
March10 T C 11: 105,382,237 E692G probably damaging Het
Mars G A 10: 127,296,560 T856M probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pepd G A 7: 34,969,543 R196H probably damaging Het
Pla2g4e A T 2: 120,182,738 M367K probably benign Het
Prdm4 A G 10: 85,910,221 probably null Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Serpina3k A T 12: 104,340,722 N71I probably damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Smc4 T C 3: 69,027,891 V771A probably benign Het
Snapc4 A G 2: 26,378,551 S33P probably benign Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tjp3 T A 10: 81,281,117 R193* probably null Het
Tm7sf2 A T 19: 6,067,200 W58R probably damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Utrn T A 10: 12,501,476 Y2612F probably benign Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp382 G A 7: 30,131,629 probably null Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164260861 missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164260880 missense probably damaging 1.00
R0324:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R0709:Slc19a2 UTSW 1 164256798 missense probably damaging 1.00
R1117:Slc19a2 UTSW 1 164263456 missense possibly damaging 0.86
R1165:Slc19a2 UTSW 1 164263445 missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164257197 missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164262184 missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164262088 missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164249413 missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164260882 missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164263456 missense probably benign 0.00
R6279:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6907:Slc19a2 UTSW 1 164262754 missense possibly damaging 0.79
R6917:Slc19a2 UTSW 1 164261009 missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164256859 missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164260822 missense probably benign 0.00
R7424:Slc19a2 UTSW 1 164260876 missense probably benign 0.31
R7575:Slc19a2 UTSW 1 164257122 missense probably damaging 1.00
R8193:Slc19a2 UTSW 1 164257225 missense probably benign 0.13
R8831:Slc19a2 UTSW 1 164256874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCTACTCCAGGAGTTACC -3'
(R):5'- TGACTTTCTGGTACATGCCC -3'

Sequencing Primer
(F):5'- AGTTACCTGAACTTACTGTGGCCAG -3'
(R):5'- CAGGTCCACCACAGTATAGATATAGG -3'
Posted On2018-04-02