Incidental Mutation 'R6300:Pepd'
ID509025
Institutional Source Beutler Lab
Gene Symbol Pepd
Ensembl Gene ENSMUSG00000063931
Gene Namepeptidase D
SynonymsPep4, Pep-4, dal, peptidase D
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6300 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location34912379-35044708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34969543 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 196 (R196H)
Ref Sequence ENSEMBL: ENSMUSP00000075683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075068]
Predicted Effect probably damaging
Transcript: ENSMUST00000075068
AA Change: R196H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931
AA Change: R196H

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161128
Predicted Effect unknown
Transcript: ENSMUST00000161900
AA Change: R48H
SMART Domains Protein: ENSMUSP00000133634
Gene: ENSMUSG00000063931
AA Change: R48H

DomainStartEndE-ValueType
Blast:AMP_N 2 35 3e-15 BLAST
PDB:2OKN|B 2 76 1e-43 PDB
SCOP:d1b6a_2 7 77 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162509
Meta Mutation Damage Score 0.5849 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,993,461 T185A possibly damaging Het
4932414N04Rik A G 2: 68,731,109 Y260C possibly damaging Het
Adamtsl1 G A 4: 86,248,017 G395S probably damaging Het
Amn T C 12: 111,274,189 L85P probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apip C T 2: 103,087,153 R66C possibly damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Apol6 A T 15: 77,051,271 I247L probably benign Het
Arfgap2 A G 2: 91,267,195 Q112R probably benign Het
Armh1 A G 4: 117,231,782 Y139H probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cct2 C T 10: 117,056,159 G328D probably damaging Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cers5 G T 15: 99,772,219 A54E probably damaging Het
Ctdp1 T A 18: 80,459,240 M152L probably benign Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Defb36 T A 2: 152,612,498 W26R probably damaging Het
Dnah17 T C 11: 118,034,310 E3899G probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Duox1 T G 2: 122,337,700 L1102R probably damaging Het
Dzip3 A G 16: 48,951,807 S500P probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Hoxd3 A G 2: 74,744,076 Y22C probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il6ra A G 3: 89,887,129 V175A probably damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
March10 T C 11: 105,382,237 E692G probably damaging Het
Mars G A 10: 127,296,560 T856M probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pla2g4e A T 2: 120,182,738 M367K probably benign Het
Prdm4 A G 10: 85,910,221 probably null Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Serpina3k A T 12: 104,340,722 N71I probably damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Smc4 T C 3: 69,027,891 V771A probably benign Het
Snapc4 A G 2: 26,378,551 S33P probably benign Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tjp3 T A 10: 81,281,117 R193* probably null Het
Tm7sf2 A T 19: 6,067,200 W58R probably damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Utrn T A 10: 12,501,476 Y2612F probably benign Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp382 G A 7: 30,131,629 probably null Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Pepd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pepd APN 7 34924440 missense probably benign
IGL02102:Pepd APN 7 34945603 missense probably damaging 1.00
R1256:Pepd UTSW 7 34921492 missense possibly damaging 0.95
R1690:Pepd UTSW 7 35031357 missense probably damaging 1.00
R1734:Pepd UTSW 7 35031426 missense probably benign 0.07
R1911:Pepd UTSW 7 34934749 splice site probably benign
R1918:Pepd UTSW 7 34971676 missense probably benign 0.00
R2144:Pepd UTSW 7 34921418 missense probably benign 0.09
R4814:Pepd UTSW 7 34945597 missense probably damaging 0.96
R4924:Pepd UTSW 7 35020984 missense probably benign 0.24
R5490:Pepd UTSW 7 34942690 splice site probably null
R5669:Pepd UTSW 7 35040674 missense probably benign 0.38
R6240:Pepd UTSW 7 35021751 missense probably benign 0.00
R6479:Pepd UTSW 7 35040722 missense probably benign 0.00
R6995:Pepd UTSW 7 35021719 missense probably damaging 1.00
R7303:Pepd UTSW 7 35021772 critical splice donor site probably null
R7587:Pepd UTSW 7 34969540 missense probably damaging 1.00
R8008:Pepd UTSW 7 35021701 missense probably benign 0.22
R8672:Pepd UTSW 7 34942682 missense probably damaging 0.97
R8815:Pepd UTSW 7 34971691 missense probably damaging 1.00
X0021:Pepd UTSW 7 34954563 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCTCAGGATTGCACGTTG -3'
(R):5'- TTCCTGATCCCTGCCCAAAG -3'

Sequencing Primer
(F):5'- CTCAGGATTGCACGTTGCCATG -3'
(R):5'- ATGTTCCTGCCTCCAAGGAG -3'
Posted On2018-04-02