Incidental Mutation 'R6300:Nek5'
ID509031
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6300 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22107721 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 281 (M281L)
Ref Sequence ENSEMBL: ENSMUSP00000148211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000209656]
Predicted Effect probably benign
Transcript: ENSMUST00000169834
AA Change: M281L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738
AA Change: M281L

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209656
AA Change: M281L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000210824
AA Change: H226L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213644
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,993,461 T185A possibly damaging Het
4932414N04Rik A G 2: 68,731,109 Y260C possibly damaging Het
Adamtsl1 G A 4: 86,248,017 G395S probably damaging Het
Amn T C 12: 111,274,189 L85P probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apip C T 2: 103,087,153 R66C possibly damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Apol6 A T 15: 77,051,271 I247L probably benign Het
Arfgap2 A G 2: 91,267,195 Q112R probably benign Het
Armh1 A G 4: 117,231,782 Y139H probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cct2 C T 10: 117,056,159 G328D probably damaging Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cers5 G T 15: 99,772,219 A54E probably damaging Het
Ctdp1 T A 18: 80,459,240 M152L probably benign Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Defb36 T A 2: 152,612,498 W26R probably damaging Het
Dnah17 T C 11: 118,034,310 E3899G probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Duox1 T G 2: 122,337,700 L1102R probably damaging Het
Dzip3 A G 16: 48,951,807 S500P probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Hoxd3 A G 2: 74,744,076 Y22C probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il6ra A G 3: 89,887,129 V175A probably damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
March10 T C 11: 105,382,237 E692G probably damaging Het
Mars G A 10: 127,296,560 T856M probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pepd G A 7: 34,969,543 R196H probably damaging Het
Pla2g4e A T 2: 120,182,738 M367K probably benign Het
Prdm4 A G 10: 85,910,221 probably null Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Serpina3k A T 12: 104,340,722 N71I probably damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Smc4 T C 3: 69,027,891 V771A probably benign Het
Snapc4 A G 2: 26,378,551 S33P probably benign Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tjp3 T A 10: 81,281,117 R193* probably null Het
Tm7sf2 A T 19: 6,067,200 W58R probably damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Utrn T A 10: 12,501,476 Y2612F probably benign Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp382 G A 7: 30,131,629 probably null Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8350:Nek5 UTSW 8 22113672 missense probably damaging 0.98
R8847:Nek5 UTSW 8 22123579 missense probably benign 0.01
R8888:Nek5 UTSW 8 22090479 critical splice donor site probably null
R8933:Nek5 UTSW 8 22111210 missense probably damaging 1.00
R8933:Nek5 UTSW 8 22120843 missense probably damaging 1.00
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTTCATGATTGTCAAGGGCAAC -3'
(R):5'- ACGTCCCTTTTGAAAAGACCC -3'

Sequencing Primer
(F):5'- AAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- AGACCCTTTTTAGAAACTCTCATTGC -3'
Posted On2018-04-02