Incidental Mutation 'R6301:Rp1'
ID509071
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Nameretinitis pigmentosa 1 (human)
SynonymsDcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location3999557-4409241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4347254 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1212 (K1212E)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
Predicted Effect probably benign
Transcript: ENSMUST00000027032
AA Change: K1212E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: K1212E

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208793
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCACAAGCCTCATGGGAATAC -3'
(R):5'- TTGCCATCACAGAGGAAGCTG -3'

Sequencing Primer
(F):5'- TCTGTAAGGAAACAGGCCCCTG -3'
(R):5'- AGCTGATGACTTGAAGGCTGC -3'
Posted On2018-04-02