Mutagenetix > Incidental Mutation

Incidental Mutation 'R6301:Trim72'

509098

Institutional Source

Beutler Lab

Gene Symbol

Trim72

Ensembl Gene

ENSMUSG00000042828

Gene Name

tripartite motif-containing 72

Synonyms

mitsugumin 53, MG53

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R6301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128003949-128011033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128004614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 44 (E44V)

Ref Sequence

ENSEMBL: ENSMUSP00000101855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081042] [ENSMUST00000106248]

AlphaFold

Q1XH17

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081042
AA Change: E44V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079832
Gene: ENSMUSG00000042828
AA Change: E44V

Domain	Start	End	E-Value	Type
RING	14	56	5.14e-7	SMART
BBOX	81	122	3.89e-7	SMART
coiled coil region	135	169	N/A	INTRINSIC
coiled coil region	204	232	N/A	INTRINSIC
PRY	288	341	6.48e-13	SMART
Pfam:SPRY	342	472	4.9e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106248
AA Change: E44V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101855
Gene: ENSMUSG00000042828
AA Change: E44V

Domain	Start	End	E-Value	Type
RING	14	56	5.14e-7	SMART
BBOX	81	122	3.89e-7	SMART
coiled coil region	135	169	N/A	INTRINSIC
coiled coil region	204	232	N/A	INTRINSIC
PRY	288	341	6.48e-13	SMART
Pfam:SPRY	344	465	1.7e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206216

Meta Mutation Damage Score

0.0838

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice with disruption of this gene display muscle pathologies that develop with age. Mice homozygous for a knock-out allele exhibit enhanced myogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot10	T	C	15: 20,666,262	N131S	probably benign	Het
Agbl5	A	G	5: 30,891,833	Y220C	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Ap3b1	A	T	13: 94,528,295	Q914L	unknown	Het
Arhgef25	T	C	10: 127,185,882	D216G	possibly damaging	Het
Bcas2	T	A	3: 103,171,871		probably benign	Het
Bpifb5	A	C	2: 154,230,219	H282P	possibly damaging	Het
Ccdc167	A	G	17: 29,705,582	I15T	probably damaging	Het
Cd248	A	G	19: 5,069,981	N619S	probably benign	Het
Chrna1	A	G	2: 73,570,484	F234S	possibly damaging	Het
Clcc1	T	G	3: 108,673,366	M332R	probably damaging	Het
Cmklr1	T	A	5: 113,614,938	M1L	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,037	M109V	probably benign	Het
Coq2	A	G	5: 100,661,863	I18T	possibly damaging	Het
Crybg3	T	C	16: 59,530,338	S880G	probably damaging	Het
Cubn	A	G	2: 13,478,078	C286R	probably damaging	Het
Defa24	T	C	8: 21,735,283	V63A	probably benign	Het
Dnah6	C	T	6: 73,086,217	R2634H	probably damaging	Het
Dusp8	T	A	7: 142,083,019		probably null	Het
Elac1	T	C	18: 73,738,868	D352G	probably damaging	Het
Ermap	A	T	4: 119,185,603	V241E	probably damaging	Het
Fgf10	T	A	13: 118,715,511	M43K	probably benign	Het
Gabrd	A	G	4: 155,387,267	V193A	probably damaging	Het
Gm13124	C	T	4: 144,558,654	A138T	probably damaging	Het
Gm6588	A	T	5: 112,450,468	I294F	possibly damaging	Het
Gm884	A	T	11: 103,618,930		probably benign	Het
Hectd4	T	G	5: 121,254,220	C182W	possibly damaging	Het
Hook3	C	T	8: 26,034,940	W26*	probably null	Het
Kif1a	C	A	1: 93,054,941	E714*	probably null	Het
Krt6b	T	C	15: 101,678,951	E236G	probably damaging	Het
Large2	A	G	2: 92,369,516	L209P	probably damaging	Het
Lats1	A	G	10: 7,703,107	N665S	probably benign	Het
Lrrtm3	T	C	10: 64,089,222	I55M	probably benign	Het
Ltk	A	G	2: 119,751,757	S838P	probably damaging	Het
Ltn1	T	C	16: 87,420,306	I348V	probably benign	Het
Mag	T	A	7: 30,900,679	S559C	probably damaging	Het
Mink1	A	G	11: 70,612,294	H1072R	possibly damaging	Het
Mycbp2	T	A	14: 103,155,426	Q833L	probably damaging	Het
Myh4	G	A	11: 67,255,333	E1406K	possibly damaging	Het
Npc1	C	T	18: 12,197,245	V950I	probably benign	Het
Npl	A	G	1: 153,518,881		probably null	Het
Olfr1493-ps1	A	G	19: 13,726,389	I43V	probably benign	Het
Olfr165	A	T	16: 19,407,417	F200I	possibly damaging	Het
Olfr743	T	A	14: 50,534,254	F281I	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Oxsm	A	T	14: 16,242,220	I183N	probably damaging	Het
Pde7a	T	C	3: 19,243,163	I108V	probably benign	Het
Pgghg	A	T	7: 140,946,376	T585S	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,525	D3949N	probably damaging	Het
Ralgapa2	A	T	2: 146,327,411	H1777Q	possibly damaging	Het
Rela	G	A	19: 5,645,410		probably null	Het
Rilpl1	C	A	5: 124,514,539	G41W	probably damaging	Het
Rp1	T	C	1: 4,347,254	K1212E	probably benign	Het
Sgca	A	C	11: 94,972,567	L28V	probably damaging	Het
Ssmem1	A	G	6: 30,519,759	R148G	probably damaging	Het
St8sia5	A	T	18: 77,246,140	N165Y	probably damaging	Het
Tbl2	A	T	5: 135,159,369	H339L	probably benign	Het
Tcof1	G	A	18: 60,828,825	P718L	probably damaging	Het
Try10	T	A	6: 41,355,589	S60T	probably benign	Het
Usp31	A	T	7: 121,648,276	S1315T	possibly damaging	Het
Xrn2	A	G	2: 147,063,342	I856V	probably benign	Het

Other mutations in Trim72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02195:Trim72	APN	7	128007964	missense	probably damaging	0.97
IGL02538:Trim72	APN	7	128004770	missense	probably damaging	1.00
IGL02794:Trim72	APN	7	128004532	missense	probably damaging	1.00
IGL03077:Trim72	APN	7	128007841	missense	probably benign
H8786:Trim72	UTSW	7	128004791	missense	probably damaging	0.99
R1101:Trim72	UTSW	7	128010247	missense	possibly damaging	0.94
R1711:Trim72	UTSW	7	128004585	missense	probably damaging	1.00
R1826:Trim72	UTSW	7	128007844	missense	possibly damaging	0.59
R1853:Trim72	UTSW	7	128009082	missense	probably benign	0.01
R1854:Trim72	UTSW	7	128009082	missense	probably benign	0.01
R2513:Trim72	UTSW	7	128004706	missense	possibly damaging	0.93
R4163:Trim72	UTSW	7	128007908	missense	probably benign	0.05
R4587:Trim72	UTSW	7	128007992	missense	probably benign	0.21
R5027:Trim72	UTSW	7	128007965	missense	probably damaging	0.99
R5067:Trim72	UTSW	7	128009967	missense	possibly damaging	0.86
R5276:Trim72	UTSW	7	128004542	missense	probably damaging	1.00
R5290:Trim72	UTSW	7	128010004	missense	probably benign	0.03
R5339:Trim72	UTSW	7	128010333	missense	probably benign
R5410:Trim72	UTSW	7	128009923	missense	probably damaging	1.00
R6594:Trim72	UTSW	7	128010048	missense	probably damaging	1.00
R6774:Trim72	UTSW	7	128010386	missense	probably damaging	1.00
R7162:Trim72	UTSW	7	128007649	missense	probably benign	0.18
R7372:Trim72	UTSW	7	128004686	missense	possibly damaging	0.63
R7937:Trim72	UTSW	7	128010319	missense	probably benign	0.03
R9228:Trim72	UTSW	7	128009143	missense	possibly damaging	0.91
R9364:Trim72	UTSW	7	128010001	missense	possibly damaging	0.60
R9668:Trim72	UTSW	7	128009920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGTAGGATTGAGCTGGAATTC -3'
(R):5'- ACGATGACCACGGTGAGAAC -3'

Sequencing Primer
(F):5'- CTGGAATTCTTGTAATGGGACTCCTC -3'
(R):5'- CACAAGTGTGCGGTCCTG -3'

Posted On

2018-04-02