Incidental Mutation 'R6301:Hook3'
ID509102
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Namehook microtubule tethering protein 3
SynonymsE330005F07Rik, 5830454D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location26021421-26119224 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 26034940 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 26 (W26*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
Predicted Effect probably null
Transcript: ENSMUST00000037182
AA Change: W669*
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: W669*

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209647
Predicted Effect probably null
Transcript: ENSMUST00000211683
AA Change: W26*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211777
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26038106 missense probably damaging 0.98
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R1806:Hook3 UTSW 8 26068659 missense probably damaging 1.00
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5253:Hook3 UTSW 8 26072291 missense probably benign
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26044327 intron probably benign
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
R7168:Hook3 UTSW 8 26071086 missense probably benign 0.02
R7856:Hook3 UTSW 8 26035221 missense probably damaging 1.00
R7988:Hook3 UTSW 8 26073647 missense probably benign 0.02
R8079:Hook3 UTSW 8 26088058 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCCTGGGAATGATGCTTTC -3'
(R):5'- CCACTCATTAGAGGTCAGTCTACAC -3'

Sequencing Primer
(F):5'- CCCTGGGAATGATGCTTTCACAATG -3'
(R):5'- GTCTACACTGCACCGTAAAATACTG -3'
Posted On2018-04-02