Mutagenetix > Incidental Mutations

Incidental Mutation 'R6301:Hook3'

509102

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 26034940 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 26 (W26*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

Predicted Effect

probably null
Transcript: ENSMUST00000037182
AA Change: W669*

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: W669*

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147613

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152144

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209647

Predicted Effect

probably null
Transcript: ENSMUST00000211683
AA Change: W26*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211777

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot10	T	C	15: 20,666,262	N131S	probably benign	Het
Agbl5	A	G	5: 30,891,833	Y220C	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Ap3b1	A	T	13: 94,528,295	Q914L	unknown	Het
Arhgef25	T	C	10: 127,185,882	D216G	possibly damaging	Het
Bcas2	T	A	3: 103,171,871		probably benign	Het
Bpifb5	A	C	2: 154,230,219	H282P	possibly damaging	Het
Ccdc167	A	G	17: 29,705,582	I15T	probably damaging	Het
Cd248	A	G	19: 5,069,981	N619S	probably benign	Het
Chrna1	A	G	2: 73,570,484	F234S	possibly damaging	Het
Clcc1	T	G	3: 108,673,366	M332R	probably damaging	Het
Cmklr1	T	A	5: 113,614,938	M1L	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,037	M109V	probably benign	Het
Coq2	A	G	5: 100,661,863	I18T	possibly damaging	Het
Crybg3	T	C	16: 59,530,338	S880G	probably damaging	Het
Cubn	A	G	2: 13,478,078	C286R	probably damaging	Het
Defa24	T	C	8: 21,735,283	V63A	probably benign	Het
Dnah6	C	T	6: 73,086,217	R2634H	probably damaging	Het
Dusp8	T	A	7: 142,083,019		probably null	Het
Elac1	T	C	18: 73,738,868	D352G	probably damaging	Het
Ermap	A	T	4: 119,185,603	V241E	probably damaging	Het
Fgf10	T	A	13: 118,715,511	M43K	probably benign	Het
Gabrd	A	G	4: 155,387,267	V193A	probably damaging	Het
Gm13124	C	T	4: 144,558,654	A138T	probably damaging	Het
Gm6588	A	T	5: 112,450,468	I294F	possibly damaging	Het
Gm884	A	T	11: 103,618,930		probably benign	Het
Hectd4	T	G	5: 121,254,220	C182W	possibly damaging	Het
Kif1a	C	A	1: 93,054,941	E714*	probably null	Het
Krt6b	T	C	15: 101,678,951	E236G	probably damaging	Het
Large2	A	G	2: 92,369,516	L209P	probably damaging	Het
Lats1	A	G	10: 7,703,107	N665S	probably benign	Het
Lrrtm3	T	C	10: 64,089,222	I55M	probably benign	Het
Ltk	A	G	2: 119,751,757	S838P	probably damaging	Het
Ltn1	T	C	16: 87,420,306	I348V	probably benign	Het
Mag	T	A	7: 30,900,679	S559C	probably damaging	Het
Mink1	A	G	11: 70,612,294	H1072R	possibly damaging	Het
Mycbp2	T	A	14: 103,155,426	Q833L	probably damaging	Het
Myh4	G	A	11: 67,255,333	E1406K	possibly damaging	Het
Npc1	C	T	18: 12,197,245	V950I	probably benign	Het
Npl	A	G	1: 153,518,881		probably null	Het
Olfr1493-ps1	A	G	19: 13,726,389	I43V	probably benign	Het
Olfr165	A	T	16: 19,407,417	F200I	possibly damaging	Het
Olfr743	T	A	14: 50,534,254	F281I	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Oxsm	A	T	14: 16,242,220	I183N	probably damaging	Het
Pde7a	T	C	3: 19,243,163	I108V	probably benign	Het
Pgghg	A	T	7: 140,946,376	T585S	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,525	D3949N	probably damaging	Het
Ralgapa2	A	T	2: 146,327,411	H1777Q	possibly damaging	Het
Rela	G	A	19: 5,645,410		probably null	Het
Rilpl1	C	A	5: 124,514,539	G41W	probably damaging	Het
Rp1	T	C	1: 4,347,254	K1212E	probably benign	Het
Sgca	A	C	11: 94,972,567	L28V	probably damaging	Het
Ssmem1	A	G	6: 30,519,759	R148G	probably damaging	Het
St8sia5	A	T	18: 77,246,140	N165Y	probably damaging	Het
Tbl2	A	T	5: 135,159,369	H339L	probably benign	Het
Tcof1	G	A	18: 60,828,825	P718L	probably damaging	Het
Trim72	A	T	7: 128,004,614	E44V	possibly damaging	Het
Try10	T	A	6: 41,355,589	S60T	probably benign	Het
Usp31	A	T	7: 121,648,276	S1315T	possibly damaging	Het
Xrn2	A	G	2: 147,063,342	I856V	probably benign	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCCTGGGAATGATGCTTTC -3'
(R):5'- CCACTCATTAGAGGTCAGTCTACAC -3'

Sequencing Primer
(F):5'- CCCTGGGAATGATGCTTTCACAATG -3'
(R):5'- GTCTACACTGCACCGTAAAATACTG -3'

Posted On

2018-04-02