Mutagenetix > Incidental Mutation

Incidental Mutation 'R6301:Ap3b1'

509116

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.408) question?

Stock #

R6301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94528295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 914 (Q914L)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

unknown
Transcript: ENSMUST00000022196
AA Change: Q914L

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: Q914L

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222383

Predicted Effect

unknown
Transcript: ENSMUST00000231916
AA Change: Q279L

Meta Mutation Damage Score

0.3719

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot10	T	C	15: 20,666,262	N131S	probably benign	Het
Agbl5	A	G	5: 30,891,833	Y220C	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef25	T	C	10: 127,185,882	D216G	possibly damaging	Het
Bcas2	T	A	3: 103,171,871		probably benign	Het
Bpifb5	A	C	2: 154,230,219	H282P	possibly damaging	Het
Ccdc167	A	G	17: 29,705,582	I15T	probably damaging	Het
Cd248	A	G	19: 5,069,981	N619S	probably benign	Het
Chrna1	A	G	2: 73,570,484	F234S	possibly damaging	Het
Clcc1	T	G	3: 108,673,366	M332R	probably damaging	Het
Cmklr1	T	A	5: 113,614,938	M1L	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,037	M109V	probably benign	Het
Coq2	A	G	5: 100,661,863	I18T	possibly damaging	Het
Crybg3	T	C	16: 59,530,338	S880G	probably damaging	Het
Cubn	A	G	2: 13,478,078	C286R	probably damaging	Het
Defa24	T	C	8: 21,735,283	V63A	probably benign	Het
Dnah6	C	T	6: 73,086,217	R2634H	probably damaging	Het
Dusp8	T	A	7: 142,083,019		probably null	Het
Elac1	T	C	18: 73,738,868	D352G	probably damaging	Het
Ermap	A	T	4: 119,185,603	V241E	probably damaging	Het
Fgf10	T	A	13: 118,715,511	M43K	probably benign	Het
Gabrd	A	G	4: 155,387,267	V193A	probably damaging	Het
Gm13124	C	T	4: 144,558,654	A138T	probably damaging	Het
Gm6588	A	T	5: 112,450,468	I294F	possibly damaging	Het
Gm884	A	T	11: 103,618,930		probably benign	Het
Hectd4	T	G	5: 121,254,220	C182W	possibly damaging	Het
Hook3	C	T	8: 26,034,940	W26*	probably null	Het
Kif1a	C	A	1: 93,054,941	E714*	probably null	Het
Krt6b	T	C	15: 101,678,951	E236G	probably damaging	Het
Large2	A	G	2: 92,369,516	L209P	probably damaging	Het
Lats1	A	G	10: 7,703,107	N665S	probably benign	Het
Lrrtm3	T	C	10: 64,089,222	I55M	probably benign	Het
Ltk	A	G	2: 119,751,757	S838P	probably damaging	Het
Ltn1	T	C	16: 87,420,306	I348V	probably benign	Het
Mag	T	A	7: 30,900,679	S559C	probably damaging	Het
Mink1	A	G	11: 70,612,294	H1072R	possibly damaging	Het
Mycbp2	T	A	14: 103,155,426	Q833L	probably damaging	Het
Myh4	G	A	11: 67,255,333	E1406K	possibly damaging	Het
Npc1	C	T	18: 12,197,245	V950I	probably benign	Het
Npl	A	G	1: 153,518,881		probably null	Het
Olfr1493-ps1	A	G	19: 13,726,389	I43V	probably benign	Het
Olfr165	A	T	16: 19,407,417	F200I	possibly damaging	Het
Olfr743	T	A	14: 50,534,254	F281I	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Oxsm	A	T	14: 16,242,220	I183N	probably damaging	Het
Pde7a	T	C	3: 19,243,163	I108V	probably benign	Het
Pgghg	A	T	7: 140,946,376	T585S	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,525	D3949N	probably damaging	Het
Ralgapa2	A	T	2: 146,327,411	H1777Q	possibly damaging	Het
Rela	G	A	19: 5,645,410		probably null	Het
Rilpl1	C	A	5: 124,514,539	G41W	probably damaging	Het
Rp1	T	C	1: 4,347,254	K1212E	probably benign	Het
Sgca	A	C	11: 94,972,567	L28V	probably damaging	Het
Ssmem1	A	G	6: 30,519,759	R148G	probably damaging	Het
St8sia5	A	T	18: 77,246,140	N165Y	probably damaging	Het
Tbl2	A	T	5: 135,159,369	H339L	probably benign	Het
Tcof1	G	A	18: 60,828,825	P718L	probably damaging	Het
Trim72	A	T	7: 128,004,614	E44V	possibly damaging	Het
Try10	T	A	6: 41,355,589	S60T	probably benign	Het
Usp31	A	T	7: 121,648,276	S1315T	possibly damaging	Het
Xrn2	A	G	2: 147,063,342	I856V	probably benign	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451087	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGTCCTGAGTATTGGCTTG -3'
(R):5'- CACACAGGGCACTCTCAGTTAG -3'

Sequencing Primer
(F):5'- AGTAGTGACTGAATGTCCTCAC -3'
(R):5'- GGGCACTCTCAGTTAGTAAATAATGC -3'

Posted On

2018-04-02