Incidental Mutation 'R6301:Oxsm'
ID509118
Institutional Source Beutler Lab
Gene Symbol Oxsm
Ensembl Gene ENSMUSG00000021786
Gene Name3-oxoacyl-ACP synthase, mitochondrial
Synonyms4933425A18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16238652-16249808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16242220 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 183 (I183N)
Ref Sequence ENSEMBL: ENSMUSP00000108244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022311] [ENSMUST00000112624] [ENSMUST00000112625]
Predicted Effect probably damaging
Transcript: ENSMUST00000022311
AA Change: I183N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022311
Gene: ENSMUSG00000021786
AA Change: I183N

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 6.7e-61 PFAM
Pfam:Ketoacyl-synt_C 299 414 3.6e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112624
AA Change: I183N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108243
Gene: ENSMUSG00000021786
AA Change: I183N

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112625
AA Change: I183N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108244
Gene: ENSMUSG00000021786
AA Change: I183N

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148121
SMART Domains Protein: ENSMUSP00000122364
Gene: ENSMUSG00000021786

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 198 9.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225889
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta-ketoacyl synthetase. The encoded enzyme is required for elongation of fatty acid chains in the mitochondria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Oxsm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Oxsm APN 14 16242076 missense probably damaging 1.00
IGL00900:Oxsm APN 14 16242023 missense probably damaging 0.96
IGL01966:Oxsm APN 14 16242520 missense probably benign
R0731:Oxsm UTSW 14 16240893 missense probably damaging 1.00
R2070:Oxsm UTSW 14 16241983 missense probably benign 0.03
R2071:Oxsm UTSW 14 16241983 missense probably benign 0.03
R4172:Oxsm UTSW 14 16242079 missense probably damaging 1.00
R5473:Oxsm UTSW 14 16242045 missense probably damaging 1.00
R6048:Oxsm UTSW 14 16242308 missense possibly damaging 0.63
R6415:Oxsm UTSW 14 16241904 missense probably benign 0.12
R6662:Oxsm UTSW 14 16242287 missense probably benign 0.02
R7490:Oxsm UTSW 14 16241066 missense probably benign 0.34
R7782:Oxsm UTSW 14 16240925 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TAATGCAAGAGTCTGTGCCC -3'
(R):5'- GTCCAAATCAGATGCCAAGTCC -3'

Sequencing Primer
(F):5'- AAGAGTCTGTGCCCCCAGC -3'
(R):5'- TCAGATGCCAAGTCCATGTC -3'
Posted On2018-04-02