Mutagenetix > Incidental Mutation

Incidental Mutation 'R6301:Tcof1'

509130

Institutional Source

Beutler Lab

Gene Symbol

Tcof1

Ensembl Gene

ENSMUSG00000024613

Gene Name

treacle ribosome biogenesis factor 1

Synonyms

treacle

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60813755-60848971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60828825 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 718 (P718L)

Ref Sequence

ENSEMBL: ENSMUSP00000130454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]

AlphaFold

O08784

Predicted Effect

probably damaging
Transcript: ENSMUST00000163446
AA Change: P718L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: P718L

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	322	2.2e-8	PFAM
Pfam:Treacle	321	793	4.6e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	855	874	N/A	INTRINSIC
low complexity region	879	893	N/A	INTRINSIC
low complexity region	916	927	N/A	INTRINSIC
low complexity region	967	977	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175934
AA Change: P718L

SMART Domains

Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: P718L

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	153	329	1.6e-12	PFAM
Pfam:Treacle	321	792	6.1e-175	PFAM
Pfam:Treacle	782	936	3.2e-16	PFAM
low complexity region	969	982	N/A	INTRINSIC
low complexity region	1025	1039	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1149	1172	N/A	INTRINSIC
low complexity region	1260	1285	N/A	INTRINSIC
coiled coil region	1306	1335	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176088

Predicted Effect

unknown
Transcript: ENSMUST00000176630
AA Change: P718L

SMART Domains

Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: P718L

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	323	2.5e-8	PFAM
Pfam:Treacle	321	793	5.9e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	843	857	N/A	INTRINSIC
low complexity region	880	891	N/A	INTRINSIC
low complexity region	933	946	N/A	INTRINSIC
low complexity region	989	1003	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1113	1136	N/A	INTRINSIC
low complexity region	1224	1249	N/A	INTRINSIC
coiled coil region	1270	1299	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000177172
AA Change: P670L

SMART Domains

Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: P670L

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	150	322	1.3e-10	PFAM
Pfam:Treacle	321	506	1.5e-78	PFAM
Pfam:Treacle	498	745	2e-105	PFAM
low complexity region	771	786	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	885	898	N/A	INTRINSIC
low complexity region	941	955	N/A	INTRINSIC
low complexity region	976	990	N/A	INTRINSIC

Meta Mutation Damage Score

0.2097

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot10	T	C	15: 20,666,262	N131S	probably benign	Het
Agbl5	A	G	5: 30,891,833	Y220C	probably damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Ap3b1	A	T	13: 94,528,295	Q914L	unknown	Het
Arhgef25	T	C	10: 127,185,882	D216G	possibly damaging	Het
Bcas2	T	A	3: 103,171,871		probably benign	Het
Bpifb5	A	C	2: 154,230,219	H282P	possibly damaging	Het
Ccdc167	A	G	17: 29,705,582	I15T	probably damaging	Het
Cd248	A	G	19: 5,069,981	N619S	probably benign	Het
Chrna1	A	G	2: 73,570,484	F234S	possibly damaging	Het
Clcc1	T	G	3: 108,673,366	M332R	probably damaging	Het
Cmklr1	T	A	5: 113,614,938	M1L	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,037	M109V	probably benign	Het
Coq2	A	G	5: 100,661,863	I18T	possibly damaging	Het
Crybg3	T	C	16: 59,530,338	S880G	probably damaging	Het
Cubn	A	G	2: 13,478,078	C286R	probably damaging	Het
Defa24	T	C	8: 21,735,283	V63A	probably benign	Het
Dnah6	C	T	6: 73,086,217	R2634H	probably damaging	Het
Dusp8	T	A	7: 142,083,019		probably null	Het
Elac1	T	C	18: 73,738,868	D352G	probably damaging	Het
Ermap	A	T	4: 119,185,603	V241E	probably damaging	Het
Fgf10	T	A	13: 118,715,511	M43K	probably benign	Het
Gabrd	A	G	4: 155,387,267	V193A	probably damaging	Het
Gm13124	C	T	4: 144,558,654	A138T	probably damaging	Het
Gm6588	A	T	5: 112,450,468	I294F	possibly damaging	Het
Gm884	A	T	11: 103,618,930		probably benign	Het
Hectd4	T	G	5: 121,254,220	C182W	possibly damaging	Het
Hook3	C	T	8: 26,034,940	W26*	probably null	Het
Kif1a	C	A	1: 93,054,941	E714*	probably null	Het
Krt6b	T	C	15: 101,678,951	E236G	probably damaging	Het
Large2	A	G	2: 92,369,516	L209P	probably damaging	Het
Lats1	A	G	10: 7,703,107	N665S	probably benign	Het
Lrrtm3	T	C	10: 64,089,222	I55M	probably benign	Het
Ltk	A	G	2: 119,751,757	S838P	probably damaging	Het
Ltn1	T	C	16: 87,420,306	I348V	probably benign	Het
Mag	T	A	7: 30,900,679	S559C	probably damaging	Het
Mink1	A	G	11: 70,612,294	H1072R	possibly damaging	Het
Mycbp2	T	A	14: 103,155,426	Q833L	probably damaging	Het
Myh4	G	A	11: 67,255,333	E1406K	possibly damaging	Het
Npc1	C	T	18: 12,197,245	V950I	probably benign	Het
Npl	A	G	1: 153,518,881		probably null	Het
Olfr1493-ps1	A	G	19: 13,726,389	I43V	probably benign	Het
Olfr165	A	T	16: 19,407,417	F200I	possibly damaging	Het
Olfr743	T	A	14: 50,534,254	F281I	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Oxsm	A	T	14: 16,242,220	I183N	probably damaging	Het
Pde7a	T	C	3: 19,243,163	I108V	probably benign	Het
Pgghg	A	T	7: 140,946,376	T585S	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,525	D3949N	probably damaging	Het
Ralgapa2	A	T	2: 146,327,411	H1777Q	possibly damaging	Het
Rela	G	A	19: 5,645,410		probably null	Het
Rilpl1	C	A	5: 124,514,539	G41W	probably damaging	Het
Rp1	T	C	1: 4,347,254	K1212E	probably benign	Het
Sgca	A	C	11: 94,972,567	L28V	probably damaging	Het
Ssmem1	A	G	6: 30,519,759	R148G	probably damaging	Het
St8sia5	A	T	18: 77,246,140	N165Y	probably damaging	Het
Tbl2	A	T	5: 135,159,369	H339L	probably benign	Het
Trim72	A	T	7: 128,004,614	E44V	possibly damaging	Het
Try10	T	A	6: 41,355,589	S60T	probably benign	Het
Usp31	A	T	7: 121,648,276	S1315T	possibly damaging	Het
Xrn2	A	G	2: 147,063,342	I856V	probably benign	Het

Other mutations in Tcof1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tcof1	APN	18	60814568	unclassified	probably benign
IGL01339:Tcof1	APN	18	60818095	utr 3 prime	probably benign
IGL02072:Tcof1	APN	18	60831565	missense	possibly damaging	0.85
IGL02160:Tcof1	APN	18	60848743	unclassified	probably benign
IGL02513:Tcof1	APN	18	60831778	missense	possibly damaging	0.51
IGL02823:Tcof1	APN	18	60816048	missense	probably benign	0.00
IGL03161:Tcof1	APN	18	60833488	missense	possibly damaging	0.86
IGL03291:Tcof1	APN	18	60829061	missense	possibly damaging	0.71
FR4304:Tcof1	UTSW	18	60835742	unclassified	probably benign
FR4589:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
FR4737:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
PIT4802001:Tcof1	UTSW	18	60831938	missense	unknown
R0569:Tcof1	UTSW	18	60829035	missense	possibly damaging	0.85
R0602:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R0744:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0782:Tcof1	UTSW	18	60816280	missense	probably damaging	0.97
R0833:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0836:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0885:Tcof1	UTSW	18	60835850	missense	possibly damaging	0.84
R1465:Tcof1	UTSW	18	60818954	splice site	probably benign
R1528:Tcof1	UTSW	18	60814999	nonsense	probably null
R1643:Tcof1	UTSW	18	60816228	missense	possibly damaging	0.72
R1919:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R1920:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R1921:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R2023:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R2108:Tcof1	UTSW	18	60835773	missense	probably damaging	0.97
R2114:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2115:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2116:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2117:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2156:Tcof1	UTSW	18	60831829	missense	possibly damaging	0.92
R2221:Tcof1	UTSW	18	60837901	missense	possibly damaging	0.51
R2229:Tcof1	UTSW	18	60832177	intron	probably benign
R2913:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R2914:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R3944:Tcof1	UTSW	18	60822837	missense	probably damaging	0.98
R3979:Tcof1	UTSW	18	60831533	missense	possibly damaging	0.71
R4049:Tcof1	UTSW	18	60832903	missense	possibly damaging	0.84
R4125:Tcof1	UTSW	18	60819601	missense	unknown
R5047:Tcof1	UTSW	18	60831914	missense	possibly damaging	0.86
R5433:Tcof1	UTSW	18	60818033	utr 3 prime	probably benign
R5546:Tcof1	UTSW	18	60831556	missense	possibly damaging	0.85
R5832:Tcof1	UTSW	18	60819539	missense	unknown
R5965:Tcof1	UTSW	18	60833418	critical splice donor site	probably null
R6480:Tcof1	UTSW	18	60814780	splice site	probably null
R6910:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R6911:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7105:Tcof1	UTSW	18	60843296	missense	probably damaging	1.00
R7225:Tcof1	UTSW	18	60828448	missense	unknown
R7356:Tcof1	UTSW	18	60818094	missense	unknown
R7467:Tcof1	UTSW	18	60831905	missense	unknown
R7536:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7804:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7818:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7863:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8006:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8007:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8008:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8063:Tcof1	UTSW	18	60838762	missense	probably damaging	1.00
R8192:Tcof1	UTSW	18	60843303	missense	probably damaging	1.00
R8200:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8203:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8204:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8207:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8217:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8300:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8517:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8518:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8553:Tcof1	UTSW	18	60831571	missense	possibly damaging	0.92
R8729:Tcof1	UTSW	18	60829073	missense	unknown
R8732:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8749:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R9800:Tcof1	UTSW	18	60816486	missense	unknown
RF001:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF007:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF009:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF010:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF011:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF013:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF015:Tcof1	UTSW	18	60833584	small insertion	probably benign
RF016:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF022:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF024:Tcof1	UTSW	18	60835738	unclassified	probably benign
RF027:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF030:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF030:Tcof1	UTSW	18	60833574	small insertion	probably benign
RF030:Tcof1	UTSW	18	60835723	unclassified	probably benign
RF031:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF031:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF035:Tcof1	UTSW	18	60833553	small insertion	probably benign
RF036:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF036:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF038:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF040:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF040:Tcof1	UTSW	18	60833583	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833576	small insertion	probably benign
RF043:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF050:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF051:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF053:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF056:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833564	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF060:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF060:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF063:Tcof1	UTSW	18	60833573	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833574	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATGGTGCTCTAACCCCAAG -3'
(R):5'- TGCTCCAACCAAGGCAAGTAG -3'

Sequencing Primer
(F):5'- GGTGCTCTAACCCCAAGTCCAG -3'
(R):5'- GGCAAGTAGGACCAGAAACCAC -3'

Posted On

2018-04-02