Incidental Mutation 'R6301:St8sia5'
ID509132
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77246140 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 165 (N165Y)
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect probably damaging
Transcript: ENSMUST00000075290
AA Change: N165Y

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: N165Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079618
AA Change: N129Y

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: N129Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
R7784:St8sia5 UTSW 18 77254550 missense probably benign 0.36
R8037:St8sia5 UTSW 18 77248542 missense possibly damaging 0.95
R8153:St8sia5 UTSW 18 77253111 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCAGAGAGTTTCCCAGTAGG -3'
(R):5'- TTGGACAAGACCAAAGCAGC -3'

Sequencing Primer
(F):5'- CCCAGACGCCAGGAAGATG -3'
(R):5'- AGCTGCATGCAGAGTGC -3'
Posted On2018-04-02