Incidental Mutation 'R6303:Qser1'
ID 509138
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Name glutamine and serine rich 1
Synonyms 4732486I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock # R6303 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 104754795-104816760 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104762830 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1704 (T1704I)
Ref Sequence ENSEMBL: ENSMUSP00000155882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
AlphaFold A0A338P6K9
Predicted Effect probably damaging
Transcript: ENSMUST00000117237
AA Change: T1614I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994
AA Change: T1614I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231375
AA Change: T1704I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1229 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cobll1 A T 2: 65,098,033 M982K possibly damaging Het
Crybg2 T C 4: 134,087,587 V1593A possibly damaging Het
Ctsh A G 9: 90,062,743 S76G possibly damaging Het
Dnajc10 T G 2: 80,350,664 D767E probably benign Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
Fbxw16 A T 9: 109,449,101 I3N probably benign Het
Fndc1 T C 17: 7,758,485 E1394G probably damaging Het
Gm19410 T C 8: 35,807,560 C1512R possibly damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Hephl1 C A 9: 15,090,152 V226F possibly damaging Het
Ilf3 G A 9: 21,403,136 probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Nlrp2 A G 7: 5,337,761 L18P probably damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Pappa G A 4: 65,204,654 G742D probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plscr5 A T 9: 92,205,556 I193F probably benign Het
Polr1b G A 2: 129,115,762 R579H probably damaging Het
Polr2a A T 11: 69,746,913 W202R probably damaging Het
Ppp4r1 A G 17: 65,824,729 K489E probably benign Het
Sik1 A G 17: 31,846,296 V776A probably damaging Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spice1 A G 16: 44,370,697 M305V probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Usp49 C A 17: 47,680,822 Q670K probably damaging Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r224 T A 17: 20,419,766 S202T possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Zfp985 A G 4: 147,583,775 I367V probably benign Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104766056 missense probably damaging 1.00
IGL00402:Qser1 APN 2 104786981 missense probably benign 0.00
IGL00417:Qser1 APN 2 104786903 missense probably damaging 1.00
IGL00756:Qser1 APN 2 104787671 missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104787631 missense probably damaging 0.99
IGL01317:Qser1 APN 2 104786979 missense probably damaging 0.99
IGL02186:Qser1 APN 2 104788261 missense probably damaging 1.00
IGL03236:Qser1 APN 2 104786532 missense probably benign 0.35
IGL03365:Qser1 APN 2 104786999 missense probably damaging 1.00
Behoove UTSW 2 104786977 nonsense probably null
I1329:Qser1 UTSW 2 104786977 nonsense probably null
R0270:Qser1 UTSW 2 104788961 missense probably benign 0.03
R0395:Qser1 UTSW 2 104762881 missense probably damaging 1.00
R0523:Qser1 UTSW 2 104789676 missense probably damaging 1.00
R0727:Qser1 UTSW 2 104777311 splice site probably benign
R1037:Qser1 UTSW 2 104760555 missense probably damaging 0.99
R1222:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1418:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1891:Qser1 UTSW 2 104790099 missense probably benign
R1974:Qser1 UTSW 2 104760541 missense probably damaging 1.00
R2200:Qser1 UTSW 2 104789013 missense probably damaging 1.00
R4179:Qser1 UTSW 2 104776384 missense probably benign 0.19
R4379:Qser1 UTSW 2 104766059 splice site probably null
R4418:Qser1 UTSW 2 104789421 missense probably damaging 1.00
R4585:Qser1 UTSW 2 104786793 missense probably benign 0.01
R4697:Qser1 UTSW 2 104787183 missense probably benign 0.00
R4749:Qser1 UTSW 2 104787304 missense probably benign 0.16
R4775:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R5010:Qser1 UTSW 2 104787831 missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104787282 missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104787431 missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104786642 missense probably damaging 1.00
R5400:Qser1 UTSW 2 104789874 missense probably damaging 1.00
R5502:Qser1 UTSW 2 104786574 missense probably benign 0.00
R5615:Qser1 UTSW 2 104789694 missense possibly damaging 0.78
R5664:Qser1 UTSW 2 104778196 missense probably damaging 1.00
R5750:Qser1 UTSW 2 104788923 missense probably damaging 1.00
R5793:Qser1 UTSW 2 104762860 missense probably damaging 1.00
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6171:Qser1 UTSW 2 104789283 missense probably damaging 1.00
R6223:Qser1 UTSW 2 104787648 missense probably benign 0.01
R6254:Qser1 UTSW 2 104790090 missense probably benign 0.07
R6653:Qser1 UTSW 2 104780260 missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104777325 missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104788130 missense probably benign 0.25
R7064:Qser1 UTSW 2 104787119 missense probably damaging 1.00
R7478:Qser1 UTSW 2 104789514 missense probably damaging 1.00
R7643:Qser1 UTSW 2 104786977 nonsense probably null
R7769:Qser1 UTSW 2 104758576 missense possibly damaging 0.65
R7836:Qser1 UTSW 2 104776234 missense probably damaging 1.00
R7938:Qser1 UTSW 2 104788967 missense probably damaging 1.00
R8209:Qser1 UTSW 2 104788725 missense probably benign 0.02
R8218:Qser1 UTSW 2 104762923 missense probably damaging 1.00
R8226:Qser1 UTSW 2 104788725 missense probably benign 0.02
R8341:Qser1 UTSW 2 104789475 missense probably damaging 0.99
R8362:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R8785:Qser1 UTSW 2 104787753 missense probably damaging 0.99
R8983:Qser1 UTSW 2 104787357 missense probably benign 0.02
R9051:Qser1 UTSW 2 104762947 missense possibly damaging 0.52
R9165:Qser1 UTSW 2 104788470 missense probably benign 0.41
R9289:Qser1 UTSW 2 104787248 missense possibly damaging 0.48
R9342:Qser1 UTSW 2 104787819 missense probably benign 0.00
R9380:Qser1 UTSW 2 104789346 nonsense probably null
T0722:Qser1 UTSW 2 104786832 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATAACTCGAGGCATGCAGAG -3'
(R):5'- CCATCCGCATGGGTATATGTG -3'

Sequencing Primer
(F):5'- GAAGACAACAGTGCCTGCTCTTG -3'
(R):5'- ACGTTTTGAATGGCTGAATTCAG -3'
Posted On 2018-04-02