Incidental Mutation 'R6303:Zfp985'
ID509148
Institutional Source Beutler Lab
Gene Symbol Zfp985
Ensembl Gene ENSMUSG00000065999
Gene Namezinc finger protein 985
SynonymsGm13154
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R6303 (G1)
Quality Score150.008
Status Validated
Chromosome4
Chromosomal Location147553277-147585198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147583775 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 367 (I367V)
Ref Sequence ENSEMBL: ENSMUSP00000080438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081742] [ENSMUST00000139784] [ENSMUST00000143885]
Predicted Effect probably benign
Transcript: ENSMUST00000081742
AA Change: I367V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080438
Gene: ENSMUSG00000065999
AA Change: I367V

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
ZnF_C2H2 238 260 8.34e-3 SMART
ZnF_C2H2 266 288 1.47e-3 SMART
ZnF_C2H2 294 316 2.36e-2 SMART
ZnF_C2H2 322 344 8.34e-3 SMART
ZnF_C2H2 350 372 7.67e-2 SMART
ZnF_C2H2 378 400 8.6e-5 SMART
ZnF_C2H2 406 428 8.6e-5 SMART
ZnF_C2H2 434 456 7.9e-4 SMART
ZnF_C2H2 462 484 1.95e-3 SMART
ZnF_C2H2 490 512 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139784
SMART Domains Protein: ENSMUSP00000123296
Gene: ENSMUSG00000065999

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143885
SMART Domains Protein: ENSMUSP00000121177
Gene: ENSMUSG00000065999

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cobll1 A T 2: 65,098,033 M982K possibly damaging Het
Crybg2 T C 4: 134,087,587 V1593A possibly damaging Het
Ctsh A G 9: 90,062,743 S76G possibly damaging Het
Dnajc10 T G 2: 80,350,664 D767E probably benign Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
Fbxw16 A T 9: 109,449,101 I3N probably benign Het
Fndc1 T C 17: 7,758,485 E1394G probably damaging Het
Gm19410 T C 8: 35,807,560 C1512R possibly damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Hephl1 C A 9: 15,090,152 V226F possibly damaging Het
Ilf3 G A 9: 21,403,136 probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Nlrp2 A G 7: 5,337,761 L18P probably damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Pappa G A 4: 65,204,654 G742D probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plscr5 A T 9: 92,205,556 I193F probably benign Het
Polr1b G A 2: 129,115,762 R579H probably damaging Het
Polr2a A T 11: 69,746,913 W202R probably damaging Het
Ppp4r1 A G 17: 65,824,729 K489E probably benign Het
Qser1 G A 2: 104,762,830 T1704I probably damaging Het
Sik1 A G 17: 31,846,296 V776A probably damaging Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spice1 A G 16: 44,370,697 M305V probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Usp49 C A 17: 47,680,822 Q670K probably damaging Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r224 T A 17: 20,419,766 S202T possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Other mutations in Zfp985
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0098:Zfp985 UTSW 4 147577109 missense probably damaging 0.97
R0324:Zfp985 UTSW 4 147582857 missense probably benign 0.00
R1307:Zfp985 UTSW 4 147583247 missense probably benign
R1594:Zfp985 UTSW 4 147583080 missense probably benign 0.05
R1657:Zfp985 UTSW 4 147584110 missense probably benign 0.01
R1667:Zfp985 UTSW 4 147583950 missense possibly damaging 0.84
R1761:Zfp985 UTSW 4 147584045 missense probably benign 0.00
R1858:Zfp985 UTSW 4 147582858 missense probably benign 0.29
R2509:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2510:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2847:Zfp985 UTSW 4 147583011 nonsense probably null
R2848:Zfp985 UTSW 4 147583011 nonsense probably null
R4245:Zfp985 UTSW 4 147582939 missense probably damaging 0.96
R4260:Zfp985 UTSW 4 147583572 missense probably damaging 1.00
R4434:Zfp985 UTSW 4 147583911 missense probably benign 0.37
R4480:Zfp985 UTSW 4 147584079 missense probably benign 0.07
R4512:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4514:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4528:Zfp985 UTSW 4 147582890 missense possibly damaging 0.49
R4836:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R4884:Zfp985 UTSW 4 147583344 missense probably benign 0.04
R5054:Zfp985 UTSW 4 147582981 missense probably damaging 0.98
R5106:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R5205:Zfp985 UTSW 4 147582911 missense probably damaging 1.00
R5266:Zfp985 UTSW 4 147582832 critical splice acceptor site probably null
R5468:Zfp985 UTSW 4 147583245 missense probably benign
R5533:Zfp985 UTSW 4 147582983 nonsense probably null
R6282:Zfp985 UTSW 4 147583348 missense probably benign 0.00
R6609:Zfp985 UTSW 4 147583121 missense probably benign
R6609:Zfp985 UTSW 4 147583667 missense probably damaging 1.00
R6722:Zfp985 UTSW 4 147583071 missense probably benign 0.26
R6858:Zfp985 UTSW 4 147583307 nonsense probably null
R7064:Zfp985 UTSW 4 147583116 missense probably benign 0.20
R7216:Zfp985 UTSW 4 147583456 missense probably damaging 1.00
R7471:Zfp985 UTSW 4 147582931 missense possibly damaging 0.75
R7583:Zfp985 UTSW 4 147583489 nonsense probably null
R7685:Zfp985 UTSW 4 147582874 missense probably benign 0.00
R8242:Zfp985 UTSW 4 147584182 missense possibly damaging 0.52
R8504:Zfp985 UTSW 4 147583426 missense possibly damaging 0.70
X0050:Zfp985 UTSW 4 147583271 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGTGACAAATGCTTTACCCACAA -3'
(R):5'- CATTTGTCACATTCACTGCATTTGTAA -3'

Sequencing Primer
(F):5'- caggagagaaacctcaca -3'
(R):5'- AGACTGCCTTTTCCAGTAAAGC -3'
Posted On2018-04-02