Incidental Mutation 'R6303:Plscr5'
ID509158
Institutional Source Beutler Lab
Gene Symbol Plscr5
Ensembl Gene ENSMUSG00000095654
Gene Namephospholipid scramblase family, member 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6303 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location92192936-92209772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92205556 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 193 (I193F)
Ref Sequence ENSEMBL: ENSMUSP00000136181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179751]
Predicted Effect probably benign
Transcript: ENSMUST00000179751
AA Change: I193F

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136181
Gene: ENSMUSG00000095654
AA Change: I193F

DomainStartEndE-ValueType
Pfam:Scramblase 47 269 1.5e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cobll1 A T 2: 65,098,033 M982K possibly damaging Het
Crybg2 T C 4: 134,087,587 V1593A possibly damaging Het
Ctsh A G 9: 90,062,743 S76G possibly damaging Het
Dnajc10 T G 2: 80,350,664 D767E probably benign Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
Fbxw16 A T 9: 109,449,101 I3N probably benign Het
Fndc1 T C 17: 7,758,485 E1394G probably damaging Het
Gm19410 T C 8: 35,807,560 C1512R possibly damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Hephl1 C A 9: 15,090,152 V226F possibly damaging Het
Ilf3 G A 9: 21,403,136 probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Nlrp2 A G 7: 5,337,761 L18P probably damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Pappa G A 4: 65,204,654 G742D probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Polr1b G A 2: 129,115,762 R579H probably damaging Het
Polr2a A T 11: 69,746,913 W202R probably damaging Het
Ppp4r1 A G 17: 65,824,729 K489E probably benign Het
Qser1 G A 2: 104,762,830 T1704I probably damaging Het
Sik1 A G 17: 31,846,296 V776A probably damaging Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spice1 A G 16: 44,370,697 M305V probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Usp49 C A 17: 47,680,822 Q670K probably damaging Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r224 T A 17: 20,419,766 S202T possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Zfp985 A G 4: 147,583,775 I367V probably benign Het
Other mutations in Plscr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
rambler UTSW 9 92198598 missense probably benign
scrambler UTSW 9 92205511 nonsense probably null
R1710:Plscr5 UTSW 9 92205528 missense probably damaging 1.00
R2157:Plscr5 UTSW 9 92198497 missense probably benign
R4190:Plscr5 UTSW 9 92198598 missense probably benign
R5093:Plscr5 UTSW 9 92198521 missense probably benign 0.00
R5308:Plscr5 UTSW 9 92198512 missense possibly damaging 0.63
R5639:Plscr5 UTSW 9 92205511 nonsense probably null
R5693:Plscr5 UTSW 9 92205511 nonsense probably null
R5694:Plscr5 UTSW 9 92205511 nonsense probably null
R5700:Plscr5 UTSW 9 92205511 nonsense probably null
R5701:Plscr5 UTSW 9 92205511 nonsense probably null
R6009:Plscr5 UTSW 9 92204435 nonsense probably null
R6091:Plscr5 UTSW 9 92204384 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GTCAGAAGAAAATACTGCTTTGCATCC -3'
(R):5'- TTAGAATCTCTGGAGTGATGGC -3'

Sequencing Primer
(F):5'- AATACTGCTTTGCATCCTAGAAAC -3'
(R):5'- CTGGAGTGATGGCTATTATTATAAGC -3'
Posted On2018-04-02