Mutagenetix > Incidental Mutations

Incidental Mutation 'R6303:Gramd4'

509168

Institutional Source

Beutler Lab

Gene Symbol

Gramd4

Ensembl Gene

ENSMUSG00000035900

Gene Name

GRAM domain containing 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6303 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86057695-86137634 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86134919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 596 (E596G)

Ref Sequence

ENSEMBL: ENSMUSP00000120796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044332] [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]

AlphaFold

Q8CB44

Predicted Effect

probably benign
Transcript: ENSMUST00000044332

SMART Domains

Protein: ENSMUSP00000038203
Gene: ENSMUSG00000035891

Domain	Start	End	E-Value	Type
Blast:PH	8	126	9e-39	BLAST
Pfam:DAGK_cat	132	274	1.1e-31	PFAM
low complexity region	356	367	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000088931

SMART Domains

Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900

Domain	Start	End	E-Value	Type
coiled coil region	132	190	N/A	INTRINSIC
transmembrane domain	301	323	N/A	INTRINSIC
transmembrane domain	400	422	N/A	INTRINSIC
GRAM	500	578	8.41e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123349

SMART Domains

Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138134
AA Change: E596G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900
AA Change: E596G

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC
transmembrane domain	375	397	N/A	INTRINSIC
GRAM	475	553	3.86e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150767

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,290,368	K2269N	possibly damaging	Het
5330417C22Rik	A	C	3: 108,461,256	C806W	probably damaging	Het
Apol9b	T	A	15: 77,735,304	V100E	probably damaging	Het
Bin3	A	G	14: 70,137,176	D218G	possibly damaging	Het
Cobll1	A	T	2: 65,098,033	M982K	possibly damaging	Het
Crybg2	T	C	4: 134,087,587	V1593A	possibly damaging	Het
Ctsh	A	G	9: 90,062,743	S76G	possibly damaging	Het
Dnajc10	T	G	2: 80,350,664	D767E	probably benign	Het
Etaa1	A	C	11: 17,947,505	M204R	probably damaging	Het
Fbxw16	A	T	9: 109,449,101	I3N	probably benign	Het
Fndc1	T	C	17: 7,758,485	E1394G	probably damaging	Het
Gm19410	T	C	8: 35,807,560	C1512R	possibly damaging	Het
Hephl1	C	A	9: 15,090,152	V226F	possibly damaging	Het
Ilf3	G	A	9: 21,403,136		probably benign	Het
Kcnh3	T	C	15: 99,227,038	V123A	probably benign	Het
Kdm2b	A	G	5: 122,881,744	S260P	probably benign	Het
Lingo4	G	A	3: 94,403,206	G484R	probably damaging	Het
Lrrc10b	T	C	19: 10,456,978	Q113R	probably benign	Het
Lrrc8c	A	T	5: 105,608,609	N750I	probably benign	Het
Nlrp2	A	G	7: 5,337,761	L18P	probably damaging	Het
Nrp2	T	C	1: 62,745,406	L238P	probably damaging	Het
Nup155	T	C	15: 8,118,042	S262P	probably damaging	Het
Olfr639	G	A	7: 104,012,031	L224F	probably damaging	Het
Pappa	G	A	4: 65,204,654	G742D	probably damaging	Het
Pclo	A	T	5: 14,677,893		probably benign	Het
Phyhipl	A	G	10: 70,559,557		probably null	Het
Plcg1	A	G	2: 160,761,463	T1185A	possibly damaging	Het
Plscr5	A	T	9: 92,205,556	I193F	probably benign	Het
Polr1b	G	A	2: 129,115,762	R579H	probably damaging	Het
Polr2a	A	T	11: 69,746,913	W202R	probably damaging	Het
Ppp4r1	A	G	17: 65,824,729	K489E	probably benign	Het
Qser1	G	A	2: 104,762,830	T1704I	probably damaging	Het
Sik1	A	G	17: 31,846,296	V776A	probably damaging	Het
Soga1	T	C	2: 157,040,764	N456S	possibly damaging	Het
Spice1	A	G	16: 44,370,697	M305V	probably benign	Het
Taf4b	T	C	18: 14,807,355	I297T	probably damaging	Het
Trim14	C	A	4: 46,522,118	M186I	probably benign	Het
Usp49	C	A	17: 47,680,822	Q670K	probably damaging	Het
Usp54	T	C	14: 20,560,968	D1260G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,766	S202T	possibly damaging	Het
Vmn1r3	T	A	4: 3,184,975	T111S	probably damaging	Het
Zfp985	A	G	4: 147,583,775	I367V	probably benign	Het

Other mutations in Gramd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02983:Gramd4	APN	15	86127018	missense	probably damaging	0.97
Grasping	UTSW	15	86091503	missense	probably damaging	0.99
R0053:Gramd4	UTSW	15	86130138	splice site	probably benign
R0622:Gramd4	UTSW	15	86091389	missense	probably damaging	1.00
R1401:Gramd4	UTSW	15	86125196	missense	probably damaging	1.00
R1741:Gramd4	UTSW	15	86091529	splice site	probably null
R1840:Gramd4	UTSW	15	86130192	critical splice donor site	probably null
R1968:Gramd4	UTSW	15	86132905	missense	probably damaging	1.00
R2909:Gramd4	UTSW	15	86122183	nonsense	probably null
R4345:Gramd4	UTSW	15	86134893	missense	probably damaging	1.00
R4431:Gramd4	UTSW	15	86130160	missense	probably damaging	1.00
R4832:Gramd4	UTSW	15	86134856	missense	probably benign
R5164:Gramd4	UTSW	15	86100831	missense	probably benign	0.16
R5216:Gramd4	UTSW	15	86134785	critical splice acceptor site	probably null
R5898:Gramd4	UTSW	15	86100784	missense	probably damaging	1.00
R5959:Gramd4	UTSW	15	86127557	missense	probably damaging	0.99
R6304:Gramd4	UTSW	15	86134919	missense	possibly damaging	0.72
R6678:Gramd4	UTSW	15	86091503	missense	probably damaging	0.99
R6678:Gramd4	UTSW	15	86091504	missense	possibly damaging	0.52
R6980:Gramd4	UTSW	15	86131969	missense	probably benign	0.17
R7371:Gramd4	UTSW	15	86135406	missense	probably benign	0.04
R7557:Gramd4	UTSW	15	86100900	nonsense	probably null
R7922:Gramd4	UTSW	15	86131958	missense	probably benign	0.07
R8874:Gramd4	UTSW	15	86100892	missense	probably damaging	0.97
R9127:Gramd4	UTSW	15	86091324	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGTGTCCTTGTACCTGACC -3'
(R):5'- TCTGGGCCTCCTGTAACTGTATG -3'

Sequencing Primer
(F):5'- CCTTGTACCTGACCTGTAGGAG -3'
(R):5'- TGTAACTGTATGGCGCCCAC -3'

Posted On

2018-04-02