Mutagenetix > Incidental Mutations

Incidental Mutation 'R6303:Taf4b'

509176

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R6303 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14807355 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 297 (I297T)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000169862
AA Change: I297T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: I297T

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Meta Mutation Damage Score

0.5966

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,290,368	K2269N	possibly damaging	Het
5330417C22Rik	A	C	3: 108,461,256	C806W	probably damaging	Het
Apol9b	T	A	15: 77,735,304	V100E	probably damaging	Het
Bin3	A	G	14: 70,137,176	D218G	possibly damaging	Het
Cobll1	A	T	2: 65,098,033	M982K	possibly damaging	Het
Crybg2	T	C	4: 134,087,587	V1593A	possibly damaging	Het
Ctsh	A	G	9: 90,062,743	S76G	possibly damaging	Het
Dnajc10	T	G	2: 80,350,664	D767E	probably benign	Het
Etaa1	A	C	11: 17,947,505	M204R	probably damaging	Het
Fbxw16	A	T	9: 109,449,101	I3N	probably benign	Het
Fndc1	T	C	17: 7,758,485	E1394G	probably damaging	Het
Gm19410	T	C	8: 35,807,560	C1512R	possibly damaging	Het
Gramd4	A	G	15: 86,134,919	E596G	possibly damaging	Het
Hephl1	C	A	9: 15,090,152	V226F	possibly damaging	Het
Ilf3	G	A	9: 21,403,136		probably benign	Het
Kcnh3	T	C	15: 99,227,038	V123A	probably benign	Het
Kdm2b	A	G	5: 122,881,744	S260P	probably benign	Het
Lingo4	G	A	3: 94,403,206	G484R	probably damaging	Het
Lrrc10b	T	C	19: 10,456,978	Q113R	probably benign	Het
Lrrc8c	A	T	5: 105,608,609	N750I	probably benign	Het
Nlrp2	A	G	7: 5,337,761	L18P	probably damaging	Het
Nrp2	T	C	1: 62,745,406	L238P	probably damaging	Het
Nup155	T	C	15: 8,118,042	S262P	probably damaging	Het
Olfr639	G	A	7: 104,012,031	L224F	probably damaging	Het
Pappa	G	A	4: 65,204,654	G742D	probably damaging	Het
Pclo	A	T	5: 14,677,893		probably benign	Het
Phyhipl	A	G	10: 70,559,557		probably null	Het
Plcg1	A	G	2: 160,761,463	T1185A	possibly damaging	Het
Plscr5	A	T	9: 92,205,556	I193F	probably benign	Het
Polr1b	G	A	2: 129,115,762	R579H	probably damaging	Het
Polr2a	A	T	11: 69,746,913	W202R	probably damaging	Het
Ppp4r1	A	G	17: 65,824,729	K489E	probably benign	Het
Qser1	G	A	2: 104,762,830	T1704I	probably damaging	Het
Sik1	A	G	17: 31,846,296	V776A	probably damaging	Het
Soga1	T	C	2: 157,040,764	N456S	possibly damaging	Het
Spice1	A	G	16: 44,370,697	M305V	probably benign	Het
Trim14	C	A	4: 46,522,118	M186I	probably benign	Het
Usp49	C	A	17: 47,680,822	Q670K	probably damaging	Het
Usp54	T	C	14: 20,560,968	D1260G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,766	S202T	possibly damaging	Het
Vmn1r3	T	A	4: 3,184,975	T111S	probably damaging	Het
Zfp985	A	G	4: 147,583,775	I367V	probably benign	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCCTGTAAAGGTGGAATTTACTAC -3'
(R):5'- CTGTTCAAATCAATACTGTGTTGGC -3'

Sequencing Primer
(F):5'- GTCTGTAGTCATAAAGTACTTTGCC -3'
(R):5'- TCTCTCATCATTAGTACACTCACAG -3'

Posted On

2018-04-02