Mutagenetix > Incidental Mutation

Incidental Mutation 'R6304:Plcg1'

509183

Institutional Source

Beutler Lab

Gene Symbol

Plcg1

Ensembl Gene

ENSMUSG00000016933

Gene Name

phospholipase C, gamma 1

Synonyms

Cded, Plc-gamma1, Plcg-1, Plc-1

MMRRC Submission

044380-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6304 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

160731300-160775760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160761463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1185 (T1185A)

Ref Sequence

ENSEMBL: ENSMUSP00000105088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]

AlphaFold

Q62077

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000017077

Predicted Effect

probably benign
Transcript: ENSMUST00000103111

SMART Domains

Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART
ZnF_C2H2	109	132	1.08e1	SMART
low complexity region	167	189	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
HOX	300	362	1.48e-6	SMART
low complexity region	434	447	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
HOX	489	551	2.25e-11	SMART
HOX	608	669	2.04e-9	SMART
low complexity region	677	690	N/A	INTRINSIC
HOX	759	821	7.49e-8	SMART
Pfam:Homez	836	888	5.2e-26	PFAM
low complexity region	919	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103112

SMART Domains

Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART
ZnF_C2H2	109	132	1.08e1	SMART
low complexity region	167	189	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
HOX	300	362	1.48e-6	SMART
low complexity region	434	447	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
HOX	489	551	2.25e-11	SMART
HOX	608	669	2.04e-9	SMART
low complexity region	677	690	N/A	INTRINSIC
HOX	759	821	7.49e-8	SMART
Pfam:Homez	836	888	5.2e-26	PFAM
low complexity region	919	936	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103115
AA Change: T1185A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: T1185A

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109462
AA Change: T1185A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: T1185A

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	240	318	5.2e-8	PFAM
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133937

Predicted Effect

unknown
Transcript: ENSMUST00000143997
AA Change: T96A

SMART Domains

Protein: ENSMUSP00000115181
Gene: ENSMUSG00000016933
AA Change: T96A

Domain	Start	End	E-Value	Type
C2	1	104	3.15e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147254

Predicted Effect

probably benign
Transcript: ENSMUST00000151590

SMART Domains

Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	239	318	4.4e-8	PFAM
PLCXc	320	464	3.7e-91	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173335

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173791

Meta Mutation Damage Score

0.0943

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,290,368	K2269N	possibly damaging	Het
5330417C22Rik	A	C	3: 108,461,256	C806W	probably damaging	Het
Apol9b	T	A	15: 77,735,304	V100E	probably damaging	Het
Bin3	A	G	14: 70,137,176	D218G	possibly damaging	Het
Cbll1	A	G	12: 31,494,589		probably null	Het
Cped1	A	T	6: 22,016,923	R90S	probably benign	Het
Csmd1	A	T	8: 16,058,674	L1905Q	probably damaging	Het
Etaa1	A	C	11: 17,947,505	M204R	probably damaging	Het
G6pc	A	G	11: 101,367,909	D38G	probably damaging	Het
Gramd4	A	G	15: 86,134,919	E596G	possibly damaging	Het
Ifna5	T	C	4: 88,835,910	V129A	probably benign	Het
Igsf9b	C	T	9: 27,342,575	R1354W	probably benign	Het
Kcnh3	T	C	15: 99,227,038	V123A	probably benign	Het
Kcnh7	A	T	2: 62,764,616	Y703*	probably null	Het
Kdm2b	A	G	5: 122,881,744	S260P	probably benign	Het
Kdm6b	G	T	11: 69,404,258	T1061K	unknown	Het
Lingo4	G	A	3: 94,403,206	G484R	probably damaging	Het
Lpar1	T	C	4: 58,487,013	Y86C	probably damaging	Het
Lrrc10b	T	C	19: 10,456,978	Q113R	probably benign	Het
Lrrc8c	A	T	5: 105,608,609	N750I	probably benign	Het
Miip	T	C	4: 147,863,083	M207V	probably benign	Het
Mup4	T	C	4: 59,960,084	H60R	possibly damaging	Het
Naip5	C	T	13: 100,223,166	A521T	possibly damaging	Het
Nrp2	T	C	1: 62,745,406	L238P	probably damaging	Het
Nup155	T	C	15: 8,118,042	S262P	probably damaging	Het
Olfr639	G	A	7: 104,012,031	L224F	probably damaging	Het
Osbpl3	A	G	6: 50,312,674	S604P	probably damaging	Het
Pcdhb6	C	T	18: 37,335,921	R632*	probably null	Het
Pcdhb9	T	A	18: 37,401,367	V138E	probably damaging	Het
Pclo	A	T	5: 14,677,893		probably benign	Het
Phyhipl	A	G	10: 70,559,557		probably null	Het
Pomt1	T	A	2: 32,250,790	L478Q	probably damaging	Het
Robo2	T	A	16: 73,958,308	Y779F	probably damaging	Het
Sesn3	A	T	9: 14,322,561		probably null	Het
Sh3gl1	A	T	17: 56,036,431	F10Y	probably benign	Het
Soga1	T	C	2: 157,040,764	N456S	possibly damaging	Het
Spsb1	C	T	4: 149,906,731	V127I	probably benign	Het
Taf4b	T	C	18: 14,807,355	I297T	probably damaging	Het
Trim14	C	A	4: 46,522,118	M186I	probably benign	Het
Ttn	A	T	2: 76,891,099		probably benign	Het
Ttn	G	T	2: 76,915,735		probably benign	Het
Usp54	T	C	14: 20,560,968	D1260G	possibly damaging	Het
Vmn1r3	T	A	4: 3,184,975	T111S	probably damaging	Het
Vmn2r51	T	C	7: 10,098,237	Q474R	probably benign	Het
Wdr78	T	C	4: 103,087,356	E266G	probably benign	Het

Other mutations in Plcg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Plcg1	APN	2	160757266	missense	probably damaging	1.00
IGL00885:Plcg1	APN	2	160758083	missense	probably benign	0.03
IGL01066:Plcg1	APN	2	160754398	missense	probably damaging	1.00
IGL01356:Plcg1	APN	2	160753893	missense	probably damaging	1.00
IGL01629:Plcg1	APN	2	160758010	missense	possibly damaging	0.69
IGL01732:Plcg1	APN	2	160747779	missense	probably damaging	0.97
IGL01754:Plcg1	APN	2	160761433	missense	probably damaging	1.00
IGL02195:Plcg1	APN	2	160753926	missense	possibly damaging	0.83
IGL02371:Plcg1	APN	2	160753507	missense	probably damaging	0.99
IGL02671:Plcg1	APN	2	160755752	nonsense	probably null
IGL03096:Plcg1	APN	2	160757206	splice site	probably benign
IGL03129:Plcg1	APN	2	160774526	critical splice acceptor site	probably null
IGL03139:Plcg1	APN	2	160748129	critical splice donor site	probably null
IGL03211:Plcg1	APN	2	160759691	missense	possibly damaging	0.82
suscepit	UTSW	2	160753602	splice site	probably null
IGL03047:Plcg1	UTSW	2	160754879	missense	probably damaging	1.00
R0098:Plcg1	UTSW	2	160732000	missense	probably damaging	1.00
R0390:Plcg1	UTSW	2	160752366	missense	probably damaging	1.00
R0413:Plcg1	UTSW	2	160761429	missense	probably damaging	1.00
R0650:Plcg1	UTSW	2	160753363	splice site	probably benign
R0679:Plcg1	UTSW	2	160756910	missense	probably damaging	1.00
R0709:Plcg1	UTSW	2	160751778	splice site	probably null
R1719:Plcg1	UTSW	2	160753743	missense	probably null	0.94
R1721:Plcg1	UTSW	2	160731920	missense	probably damaging	0.99
R1727:Plcg1	UTSW	2	160748088	missense	probably benign	0.00
R1978:Plcg1	UTSW	2	160752578	splice site	probably null
R2277:Plcg1	UTSW	2	160755805	missense	possibly damaging	0.48
R2698:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R3832:Plcg1	UTSW	2	160754437	missense	possibly damaging	0.95
R4094:Plcg1	UTSW	2	160747841	missense	probably damaging	0.98
R4260:Plcg1	UTSW	2	160751707	critical splice donor site	probably null
R4622:Plcg1	UTSW	2	160747768	splice site	probably benign
R4837:Plcg1	UTSW	2	160750986	missense	probably benign	0.00
R4942:Plcg1	UTSW	2	160753589	splice site	probably null
R5514:Plcg1	UTSW	2	160753355	critical splice donor site	probably null
R5647:Plcg1	UTSW	2	160751668	missense	probably benign	0.45
R5929:Plcg1	UTSW	2	160753602	splice site	probably null
R6303:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6471:Plcg1	UTSW	2	160753710	missense	probably benign	0.10
R6500:Plcg1	UTSW	2	160754567	missense	probably damaging	1.00
R7017:Plcg1	UTSW	2	160758097	missense	probably damaging	1.00
R7113:Plcg1	UTSW	2	160748283	missense	possibly damaging	0.78
R7137:Plcg1	UTSW	2	160753926	missense	possibly damaging	0.83
R7155:Plcg1	UTSW	2	160754380	missense	probably damaging	1.00
R7211:Plcg1	UTSW	2	160731874	missense	probably benign	0.02
R7777:Plcg1	UTSW	2	160754603	missense	possibly damaging	0.89
R7918:Plcg1	UTSW	2	160753665	missense	probably damaging	1.00
R7934:Plcg1	UTSW	2	160774578	missense	possibly damaging	0.53
R8309:Plcg1	UTSW	2	160753933	missense	probably benign	0.00
R8344:Plcg1	UTSW	2	160747896	missense	probably benign	0.00
R8377:Plcg1	UTSW	2	160754922	missense	probably damaging	1.00
R8524:Plcg1	UTSW	2	160761467	critical splice donor site	probably null
R8708:Plcg1	UTSW	2	160754553	splice site	probably benign
R8831:Plcg1	UTSW	2	160747812	missense	probably benign	0.02
R8936:Plcg1	UTSW	2	160748066	missense	probably benign	0.02
R9414:Plcg1	UTSW	2	160761356	missense	possibly damaging	0.80
R9466:Plcg1	UTSW	2	160754600	missense	probably benign
R9608:Plcg1	UTSW	2	160755751	missense	probably benign	0.02
R9755:Plcg1	UTSW	2	160731860	missense	probably benign	0.27
Z1176:Plcg1	UTSW	2	160758127	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTTGCTTTCACAGTGGAC -3'
(R):5'- GGGGCTATGACTGAACTCTC -3'

Sequencing Primer
(F):5'- CTTTCACAGTGGACAACGGACTG -3'
(R):5'- CCTTAGCAGGGAAAATGTCAATC -3'

Posted On

2018-04-02