Incidental Mutation 'R6304:Plcg1'
ID 509183
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Name phospholipase C, gamma 1
Synonyms Plc-1, Cded, Plcg-1, Plc-gamma1
MMRRC Submission 044380-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6304 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160573230-160617680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 160603383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1185 (T1185A)
Ref Sequence ENSEMBL: ENSMUSP00000105088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]
AlphaFold Q62077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000017077
Predicted Effect probably benign
Transcript: ENSMUST00000103111
SMART Domains Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103112
SMART Domains Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103115
AA Change: T1185A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: T1185A

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109462
AA Change: T1185A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: T1185A

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124652
Predicted Effect unknown
Transcript: ENSMUST00000143997
AA Change: T96A
SMART Domains Protein: ENSMUSP00000115181
Gene: ENSMUSG00000016933
AA Change: T96A

DomainStartEndE-ValueType
C2 1 104 3.15e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect probably benign
Transcript: ENSMUST00000151590
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Meta Mutation Damage Score 0.0943 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T A 15: 77,619,504 (GRCm39) V100E probably damaging Het
Bin3 A G 14: 70,374,625 (GRCm39) D218G possibly damaging Het
Cbll1 A G 12: 31,544,588 (GRCm39) probably null Het
Cped1 A T 6: 22,016,922 (GRCm39) R90S probably benign Het
Csmd1 A T 8: 16,108,688 (GRCm39) L1905Q probably damaging Het
Dnai4 T C 4: 102,944,553 (GRCm39) E266G probably benign Het
Elapor1 A C 3: 108,368,572 (GRCm39) C806W probably damaging Het
Etaa1 A C 11: 17,897,505 (GRCm39) M204R probably damaging Het
G6pc1 A G 11: 101,258,735 (GRCm39) D38G probably damaging Het
Gramd4 A G 15: 86,019,120 (GRCm39) E596G possibly damaging Het
Ifna5 T C 4: 88,754,147 (GRCm39) V129A probably benign Het
Igsf9b C T 9: 27,253,871 (GRCm39) R1354W probably benign Het
Kcnh3 T C 15: 99,124,919 (GRCm39) V123A probably benign Het
Kcnh7 A T 2: 62,594,960 (GRCm39) Y703* probably null Het
Kdm2b A G 5: 123,019,807 (GRCm39) S260P probably benign Het
Kdm6b G T 11: 69,295,084 (GRCm39) T1061K unknown Het
Lingo4 G A 3: 94,310,513 (GRCm39) G484R probably damaging Het
Lpar1 T C 4: 58,487,013 (GRCm39) Y86C probably damaging Het
Lrrc10b T C 19: 10,434,342 (GRCm39) Q113R probably benign Het
Lrrc8c A T 5: 105,756,475 (GRCm39) N750I probably benign Het
Miip T C 4: 147,947,540 (GRCm39) M207V probably benign Het
Mtcl2 T C 2: 156,882,684 (GRCm39) N456S possibly damaging Het
Mup4 T C 4: 59,960,084 (GRCm39) H60R possibly damaging Het
Naip5 C T 13: 100,359,674 (GRCm39) A521T possibly damaging Het
Nrp2 T C 1: 62,784,565 (GRCm39) L238P probably damaging Het
Nup155 T C 15: 8,147,526 (GRCm39) S262P probably damaging Het
Or51k1 G A 7: 103,661,238 (GRCm39) L224F probably damaging Het
Osbpl3 A G 6: 50,289,654 (GRCm39) S604P probably damaging Het
Pcdhb6 C T 18: 37,468,974 (GRCm39) R632* probably null Het
Pcdhb9 T A 18: 37,534,420 (GRCm39) V138E probably damaging Het
Pclo A T 5: 14,727,907 (GRCm39) probably benign Het
Phyhipl A G 10: 70,395,387 (GRCm39) probably null Het
Pomt1 T A 2: 32,140,802 (GRCm39) L478Q probably damaging Het
Robo2 T A 16: 73,755,196 (GRCm39) Y779F probably damaging Het
Sesn3 A T 9: 14,233,857 (GRCm39) probably null Het
Sh3gl1 A T 17: 56,343,431 (GRCm39) F10Y probably benign Het
Spata31h1 T A 10: 82,126,202 (GRCm39) K2269N possibly damaging Het
Spsb1 C T 4: 149,991,188 (GRCm39) V127I probably benign Het
Taf4b T C 18: 14,940,412 (GRCm39) I297T probably damaging Het
Trim14 C A 4: 46,522,118 (GRCm39) M186I probably benign Het
Ttn G T 2: 76,746,079 (GRCm39) probably benign Het
Ttn A T 2: 76,721,443 (GRCm39) probably benign Het
Usp54 T C 14: 20,611,036 (GRCm39) D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 (GRCm39) T111S probably damaging Het
Vmn2r51 T C 7: 9,832,164 (GRCm39) Q474R probably benign Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160,599,186 (GRCm39) missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160,600,003 (GRCm39) missense probably benign 0.03
IGL01066:Plcg1 APN 2 160,596,318 (GRCm39) missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160,595,813 (GRCm39) missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160,599,930 (GRCm39) missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160,589,699 (GRCm39) missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160,603,353 (GRCm39) missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160,595,846 (GRCm39) missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160,595,427 (GRCm39) missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160,597,672 (GRCm39) nonsense probably null
IGL03096:Plcg1 APN 2 160,599,126 (GRCm39) splice site probably benign
IGL03129:Plcg1 APN 2 160,616,446 (GRCm39) critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160,590,049 (GRCm39) critical splice donor site probably null
IGL03211:Plcg1 APN 2 160,601,611 (GRCm39) missense possibly damaging 0.82
suscepit UTSW 2 160,595,522 (GRCm39) splice site probably null
IGL03047:Plcg1 UTSW 2 160,596,799 (GRCm39) missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160,573,920 (GRCm39) missense probably damaging 1.00
R0390:Plcg1 UTSW 2 160,594,286 (GRCm39) missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160,603,349 (GRCm39) missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160,595,283 (GRCm39) splice site probably benign
R0679:Plcg1 UTSW 2 160,598,830 (GRCm39) missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160,593,698 (GRCm39) splice site probably null
R1719:Plcg1 UTSW 2 160,595,663 (GRCm39) missense probably null 0.94
R1721:Plcg1 UTSW 2 160,573,840 (GRCm39) missense probably damaging 0.99
R1727:Plcg1 UTSW 2 160,590,008 (GRCm39) missense probably benign 0.00
R1978:Plcg1 UTSW 2 160,594,498 (GRCm39) splice site probably null
R2277:Plcg1 UTSW 2 160,597,725 (GRCm39) missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160,603,383 (GRCm39) missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160,596,357 (GRCm39) missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160,589,761 (GRCm39) missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160,593,627 (GRCm39) critical splice donor site probably null
R4622:Plcg1 UTSW 2 160,589,688 (GRCm39) splice site probably benign
R4837:Plcg1 UTSW 2 160,592,906 (GRCm39) missense probably benign 0.00
R4942:Plcg1 UTSW 2 160,595,509 (GRCm39) splice site probably null
R5514:Plcg1 UTSW 2 160,595,275 (GRCm39) critical splice donor site probably null
R5647:Plcg1 UTSW 2 160,593,588 (GRCm39) missense probably benign 0.45
R5929:Plcg1 UTSW 2 160,595,522 (GRCm39) splice site probably null
R6303:Plcg1 UTSW 2 160,603,383 (GRCm39) missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160,595,630 (GRCm39) missense probably benign 0.10
R6500:Plcg1 UTSW 2 160,596,487 (GRCm39) missense probably damaging 1.00
R7017:Plcg1 UTSW 2 160,600,017 (GRCm39) missense probably damaging 1.00
R7113:Plcg1 UTSW 2 160,590,203 (GRCm39) missense possibly damaging 0.78
R7137:Plcg1 UTSW 2 160,595,846 (GRCm39) missense possibly damaging 0.83
R7155:Plcg1 UTSW 2 160,596,300 (GRCm39) missense probably damaging 1.00
R7211:Plcg1 UTSW 2 160,573,794 (GRCm39) missense probably benign 0.02
R7777:Plcg1 UTSW 2 160,596,523 (GRCm39) missense possibly damaging 0.89
R7918:Plcg1 UTSW 2 160,595,585 (GRCm39) missense probably damaging 1.00
R7934:Plcg1 UTSW 2 160,616,498 (GRCm39) missense possibly damaging 0.53
R8309:Plcg1 UTSW 2 160,595,853 (GRCm39) missense probably benign 0.00
R8344:Plcg1 UTSW 2 160,589,816 (GRCm39) missense probably benign 0.00
R8377:Plcg1 UTSW 2 160,596,842 (GRCm39) missense probably damaging 1.00
R8524:Plcg1 UTSW 2 160,603,387 (GRCm39) critical splice donor site probably null
R8708:Plcg1 UTSW 2 160,596,473 (GRCm39) splice site probably benign
R8831:Plcg1 UTSW 2 160,589,732 (GRCm39) missense probably benign 0.02
R8936:Plcg1 UTSW 2 160,589,986 (GRCm39) missense probably benign 0.02
R9414:Plcg1 UTSW 2 160,603,276 (GRCm39) missense possibly damaging 0.80
R9466:Plcg1 UTSW 2 160,596,520 (GRCm39) missense probably benign
R9608:Plcg1 UTSW 2 160,597,671 (GRCm39) missense probably benign 0.02
R9755:Plcg1 UTSW 2 160,573,780 (GRCm39) missense probably benign 0.27
Z1176:Plcg1 UTSW 2 160,600,047 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGCTTTCACAGTGGAC -3'
(R):5'- GGGGCTATGACTGAACTCTC -3'

Sequencing Primer
(F):5'- CTTTCACAGTGGACAACGGACTG -3'
(R):5'- CCTTAGCAGGGAAAATGTCAATC -3'
Posted On 2018-04-02