Incidental Mutation 'R6304:Lingo4'
ID509184
Institutional Source Beutler Lab
Gene Symbol Lingo4
Ensembl Gene ENSMUSG00000044505
Gene Nameleucine rich repeat and Ig domain containing 4
SynonymsLrrn6d, LERN4, A530050P17Rik
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94398517-94404501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94403206 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 484 (G484R)
Ref Sequence ENSEMBL: ENSMUSP00000058050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050975] [ENSMUST00000197040]
Predicted Effect probably damaging
Transcript: ENSMUST00000050975
AA Change: G484R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058050
Gene: ENSMUSG00000044505
AA Change: G484R

DomainStartEndE-ValueType
LRRNT 55 89 1.23e-4 SMART
LRR 88 107 2.76e2 SMART
LRR_TYP 108 131 1.02e-6 SMART
LRR_TYP 132 155 7.26e-3 SMART
LRR 156 179 1.33e1 SMART
LRR_TYP 180 203 5.42e-2 SMART
LRR 204 227 4.45e1 SMART
LRR 228 251 3.27e1 SMART
LRR 300 323 4.83e0 SMART
LRR 324 347 3.07e-1 SMART
LRR 348 371 3.36e1 SMART
LRRCT 383 436 5.24e-5 SMART
IGc2 451 516 3.53e-13 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198829
Meta Mutation Damage Score 0.4725 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Lingo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Lingo4 APN 3 94403288 missense probably benign 0.00
IGL02662:Lingo4 APN 3 94401817 unclassified probably benign
IGL02687:Lingo4 APN 3 94402097 missense probably damaging 1.00
IGL02711:Lingo4 APN 3 94403393 missense probably benign
IGL03001:Lingo4 APN 3 94402396 missense probably damaging 1.00
IGL03260:Lingo4 APN 3 94401943 missense probably benign
PIT4449001:Lingo4 UTSW 3 94401932 missense probably benign
R0088:Lingo4 UTSW 3 94402033 missense probably benign 0.39
R0616:Lingo4 UTSW 3 94403081 missense probably benign 0.00
R1455:Lingo4 UTSW 3 94399392 unclassified probably benign
R1733:Lingo4 UTSW 3 94403178 missense probably benign 0.00
R2001:Lingo4 UTSW 3 94403075 missense probably damaging 1.00
R2085:Lingo4 UTSW 3 94402245 missense probably damaging 1.00
R3793:Lingo4 UTSW 3 94402378 missense probably benign
R3805:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R3806:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R4438:Lingo4 UTSW 3 94402897 missense possibly damaging 0.79
R4660:Lingo4 UTSW 3 94403365 missense probably benign 0.00
R4724:Lingo4 UTSW 3 94402876 nonsense probably null
R4981:Lingo4 UTSW 3 94399454 missense probably benign 0.18
R4994:Lingo4 UTSW 3 94402541 missense probably benign
R4994:Lingo4 UTSW 3 94403001 missense probably benign 0.02
R5600:Lingo4 UTSW 3 94401913 missense probably benign
R6188:Lingo4 UTSW 3 94402850 missense probably damaging 1.00
R6267:Lingo4 UTSW 3 94403390 missense probably benign 0.02
R6303:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6789:Lingo4 UTSW 3 94399355 unclassified probably benign
R7313:Lingo4 UTSW 3 94403144 missense possibly damaging 0.95
R7329:Lingo4 UTSW 3 94402855 missense probably benign
R7631:Lingo4 UTSW 3 94399460 missense possibly damaging 0.93
R7908:Lingo4 UTSW 3 94402234 missense probably benign 0.19
R8277:Lingo4 UTSW 3 94402624 missense possibly damaging 0.61
X0054:Lingo4 UTSW 3 94403376 missense possibly damaging 0.54
Z1177:Lingo4 UTSW 3 94402994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAACATGTCCAAGGGAAG -3'
(R):5'- ATCCCTGGCATAGTGATGTTGG -3'

Sequencing Primer
(F):5'- GAGCCTAAGGGAGTTTTCAGACATTC -3'
(R):5'- GGGTCAGACAGAGTGCCATTTG -3'
Posted On2018-04-02