Incidental Mutation 'R6304:Trim14'
ID 509187
Institutional Source Beutler Lab
Gene Symbol Trim14
Ensembl Gene ENSMUSG00000039853
Gene Name tripartite motif-containing 14
Synonyms
MMRRC Submission 044380-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6304 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 46493781-46536141 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 46522118 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 186 (M186I)
Ref Sequence ENSEMBL: ENSMUSP00000099988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046897] [ENSMUST00000102924] [ENSMUST00000184112]
AlphaFold Q8BVW3
Predicted Effect probably benign
Transcript: ENSMUST00000046897
AA Change: M186I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038719
Gene: ENSMUSG00000039853
AA Change: M186I

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
PRY 264 316 2.63e-13 SMART
SPRY 317 440 2.48e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102924
AA Change: M186I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099988
Gene: ENSMUSG00000039853
AA Change: M186I

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142606
Predicted Effect probably benign
Transcript: ENSMUST00000184112
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies and its function has not been determined. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Trim14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Trim14 UTSW 4 46523627 missense probably damaging 0.99
R0310:Trim14 UTSW 4 46522043 missense probably damaging 0.99
R1766:Trim14 UTSW 4 46522039 missense probably benign 0.00
R3436:Trim14 UTSW 4 46523739 missense possibly damaging 0.63
R3437:Trim14 UTSW 4 46523739 missense possibly damaging 0.63
R4085:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4086:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4087:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4088:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4992:Trim14 UTSW 4 46507110 missense probably damaging 1.00
R5408:Trim14 UTSW 4 46507134 missense possibly damaging 0.63
R5943:Trim14 UTSW 4 46522136 missense probably benign 0.01
R5979:Trim14 UTSW 4 46507239 missense probably damaging 0.97
R6029:Trim14 UTSW 4 46506998 missense probably benign 0.33
R6303:Trim14 UTSW 4 46522118 missense probably benign 0.00
R6312:Trim14 UTSW 4 46507257 missense probably damaging 1.00
R7671:Trim14 UTSW 4 46507238 missense possibly damaging 0.89
R7996:Trim14 UTSW 4 46533086 missense probably benign 0.04
R8370:Trim14 UTSW 4 46523711 missense probably damaging 1.00
R9501:Trim14 UTSW 4 46510404 missense unknown
Z1176:Trim14 UTSW 4 46510418 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAGGACTTGGAGTTGGTC -3'
(R):5'- TTGGGGCCCTAAGTATCCTG -3'

Sequencing Primer
(F):5'- ACTTGGAGTTGGTCTTAGGCAAC -3'
(R):5'- GCCCTAAGTATCCTGTGGGAG -3'
Posted On 2018-04-02