Incidental Mutation 'R6304:Lpar1'
ID509188
Institutional Source Beutler Lab
Gene Symbol Lpar1
Ensembl Gene ENSMUSG00000038668
Gene Namelysophosphatidic acid receptor 1
SynonymsGpcr26, vzg-1, Kdt2, Edg2, LPA1
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location58435255-58553898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58487013 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 86 (Y86C)
Ref Sequence ENSEMBL: ENSMUSP00000103201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055018] [ENSMUST00000107570] [ENSMUST00000107571] [ENSMUST00000107574] [ENSMUST00000107575] [ENSMUST00000145361] [ENSMUST00000147354] [ENSMUST00000155170]
Predicted Effect probably damaging
Transcript: ENSMUST00000055018
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052581
Gene: ENSMUSG00000038668
AA Change: Y86C

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 5.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107570
AA Change: Y68C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103196
Gene: ENSMUSG00000038668
AA Change: Y68C

DomainStartEndE-ValueType
Pfam:7tm_1 48 293 2.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107571
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103197
Gene: ENSMUSG00000038668
AA Change: Y86C

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107574
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103200
Gene: ENSMUSG00000038668
AA Change: Y86C

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107575
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103201
Gene: ENSMUSG00000038668
AA Change: Y86C

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119701
Predicted Effect probably benign
Transcript: ENSMUST00000145361
Predicted Effect probably benign
Transcript: ENSMUST00000147354
Predicted Effect probably benign
Transcript: ENSMUST00000155170
SMART Domains Protein: ENSMUSP00000121440
Gene: ENSMUSG00000038668

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The integral membrane protein encoded by this gene is a lysophosphatidic acid (LPA) receptor from a group known as EDG receptors. These receptors are members of the G protein-coupled receptor superfamily. Utilized by LPA for cell signaling, EDG receptors mediate diverse biologic functions, including proliferation, platelet aggregation, smooth muscle contraction, inhibition of neuroblastoma cell differentiation, chemotaxis, and tumor cell invasion. Two transcript variants encoding the same protein have been identified for this gene [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations cause partial peri- and postnatal lethality, growth defects, craniofacial anomalies, and wide set eyes. Additional phenotypes include altered brain 5-HT and amino acids, reduced prepulse inhibition, impaired suckling, and increased apoptosis in sciatic nerve Schwann cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Lpar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Lpar1 APN 4 58437407 missense probably damaging 1.00
bijou UTSW 4 58487155 missense possibly damaging 0.81
frenzied UTSW 4 58437346 missense possibly damaging 0.94
helper UTSW 4 58486875 missense possibly damaging 0.95
R0403:Lpar1 UTSW 4 58487191 missense probably damaging 1.00
R1793:Lpar1 UTSW 4 58486798 nonsense probably null
R2312:Lpar1 UTSW 4 58487168 nonsense probably null
R4279:Lpar1 UTSW 4 58487115 missense possibly damaging 0.73
R4762:Lpar1 UTSW 4 58437346 missense possibly damaging 0.94
R5391:Lpar1 UTSW 4 58486902 missense probably damaging 1.00
R5500:Lpar1 UTSW 4 58486573 missense probably benign 0.26
R5619:Lpar1 UTSW 4 58487155 missense possibly damaging 0.81
R6208:Lpar1 UTSW 4 58504630 nonsense probably null
R6464:Lpar1 UTSW 4 58486875 missense possibly damaging 0.95
R6593:Lpar1 UTSW 4 58486605 missense probably damaging 1.00
R7267:Lpar1 UTSW 4 58486857 missense possibly damaging 0.89
R7712:Lpar1 UTSW 4 58486795 missense probably benign 0.09
R8185:Lpar1 UTSW 4 58486509 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAAACCGTGATGTGCCTCTC -3'
(R):5'- CATGAACGAACAACAGTGCTTC -3'

Sequencing Primer
(F):5'- GATGTGCCTCTCGATAGCAATAGC -3'
(R):5'- CAGTGCTTCTACAATGAGTCTATCG -3'
Posted On2018-04-02