Incidental Mutation 'R6304:Miip'
ID 509192
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission 044380-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6304 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 147860778-147868816 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 147863083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 207 (M207V)
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably benign
Transcript: ENSMUST00000030886
AA Change: M207V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: M207V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119975
AA Change: M207V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: M207V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156374
Predicted Effect probably benign
Transcript: ENSMUST00000172710
AA Change: M207V

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: M207V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174081
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147865865 missense probably damaging 1.00
IGL02134:Miip APN 4 147865278 splice site probably benign
IGL02829:Miip APN 4 147863061 missense probably benign 0.01
IGL03350:Miip APN 4 147862522 missense probably benign 0.01
R0200:Miip UTSW 4 147862263 missense probably damaging 0.99
R1647:Miip UTSW 4 147865234 missense probably benign 0.02
R1783:Miip UTSW 4 147865774 missense probably damaging 1.00
R1848:Miip UTSW 4 147863092 missense probably damaging 0.99
R1944:Miip UTSW 4 147865965 missense probably benign 0.15
R3615:Miip UTSW 4 147865914 missense probably benign 0.00
R3616:Miip UTSW 4 147865914 missense probably benign 0.00
R3882:Miip UTSW 4 147861052 missense possibly damaging 0.93
R4579:Miip UTSW 4 147861061 missense probably damaging 1.00
R5183:Miip UTSW 4 147863069 missense probably damaging 1.00
R6054:Miip UTSW 4 147865678 missense probably benign 0.00
R6056:Miip UTSW 4 147862335 missense probably damaging 1.00
R6568:Miip UTSW 4 147865915 missense probably benign
R6603:Miip UTSW 4 147865923 missense possibly damaging 0.92
R7639:Miip UTSW 4 147862564 missense probably benign 0.22
R7701:Miip UTSW 4 147862914 missense probably null 0.86
R7795:Miip UTSW 4 147862918 missense probably benign 0.17
R7796:Miip UTSW 4 147862918 missense probably benign 0.17
R7797:Miip UTSW 4 147862918 missense probably benign 0.17
R7872:Miip UTSW 4 147862918 missense probably benign 0.17
R7920:Miip UTSW 4 147862918 missense probably benign 0.17
R8468:Miip UTSW 4 147861471 missense probably damaging 1.00
R8492:Miip UTSW 4 147861424 missense probably damaging 1.00
R8677:Miip UTSW 4 147863046 missense probably damaging 1.00
R8852:Miip UTSW 4 147866382 start gained probably benign
R8860:Miip UTSW 4 147866382 start gained probably benign
R9755:Miip UTSW 4 147865862 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGAAGTGGACACTCACACTC -3'
(R):5'- AGGACTCTGTGGGAATCCAGTC -3'

Sequencing Primer
(F):5'- TGGACACTCACACTCGTGGTC -3'
(R):5'- CTGTGGACTGCTGACTACAG -3'
Posted On 2018-04-02