Incidental Mutation 'R6304:Spsb1'
ID509193
Institutional Source Beutler Lab
Gene Symbol Spsb1
Ensembl Gene ENSMUSG00000039911
Gene NamesplA/ryanodine receptor domain and SOCS box containing 1
Synonyms1110014L01Rik, SSB1, 4930422J18Rik
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149896283-149955043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 149906731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 127 (V127I)
Ref Sequence ENSEMBL: ENSMUSP00000119558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038562] [ENSMUST00000105684] [ENSMUST00000105685] [ENSMUST00000125135] [ENSMUST00000149360] [ENSMUST00000149743] [ENSMUST00000156897] [ENSMUST00000167342]
Predicted Effect probably benign
Transcript: ENSMUST00000038562
AA Change: V127I

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048969
Gene: ENSMUSG00000039911
AA Change: V127I

DomainStartEndE-ValueType
SPRY 95 230 4.93e-19 SMART
SOCS_box 234 273 2.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105684
AA Change: V127I

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101309
Gene: ENSMUSG00000039911
AA Change: V127I

DomainStartEndE-ValueType
SPRY 95 230 4.93e-19 SMART
SOCS_box 234 273 2.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105685
AA Change: V127I

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101310
Gene: ENSMUSG00000039911
AA Change: V127I

DomainStartEndE-ValueType
SPRY 95 230 4.93e-19 SMART
SOCS_box 234 273 2.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146532
Predicted Effect probably benign
Transcript: ENSMUST00000149360
Predicted Effect probably benign
Transcript: ENSMUST00000149743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156451
Predicted Effect probably benign
Transcript: ENSMUST00000156897
AA Change: V127I

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119558
Gene: ENSMUSG00000039911
AA Change: V127I

DomainStartEndE-ValueType
Pfam:SPRY 95 201 5.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167342
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Spsb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Spsb1 APN 4 149907107 start codon destroyed probably null 1.00
LCD18:Spsb1 UTSW 4 149952486 intron probably benign
R0200:Spsb1 UTSW 4 149898216 makesense probably null
R0681:Spsb1 UTSW 4 149906917 missense probably benign
R0733:Spsb1 UTSW 4 149906917 missense probably benign
R0894:Spsb1 UTSW 4 149906415 critical splice donor site probably null
R0947:Spsb1 UTSW 4 149907079 missense probably benign 0.00
R1840:Spsb1 UTSW 4 149906631 missense probably damaging 0.99
R1845:Spsb1 UTSW 4 149906910 missense probably damaging 1.00
R4356:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4357:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4358:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4359:Spsb1 UTSW 4 149906775 missense probably damaging 1.00
R4656:Spsb1 UTSW 4 149906410 splice site probably null
R4970:Spsb1 UTSW 4 149907155 start gained probably benign
R6767:Spsb1 UTSW 4 149906844 missense probably damaging 1.00
R7502:Spsb1 UTSW 4 149906928 missense possibly damaging 0.88
R7615:Spsb1 UTSW 4 149906900 missense probably benign
R7944:Spsb1 UTSW 4 149906446 missense probably benign 0.00
R7974:Spsb1 UTSW 4 149907109 start codon destroyed probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGTCCCATCATCCATGTCC -3'
(R):5'- TCCTGGAACAATAACGACCG -3'

Sequencing Primer
(F):5'- ATCATCCATGTCCAGGGCC -3'
(R):5'- TGGAACAATAACGACCGTTCGC -3'
Posted On2018-04-02