Incidental Mutation 'R6304:Lrrc8c'
ID509195
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Nameleucine rich repeat containing 8 family, member C
SynonymsE430036I04Rik
MMRRC Submission 044380-MU
Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105519388-105613018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105608609 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 750 (N750I)
Ref Sequence ENSEMBL: ENSMUSP00000066015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]
Predicted Effect probably benign
Transcript: ENSMUST00000067924
AA Change: N750I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: N750I

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153754
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105607210 missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105607114 missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105608308 missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105607391 missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105607493 missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105608248 missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105607898 missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105606591 missense probably benign
IGL02536:Lrrc8c APN 5 105607172 missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105607358 missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105579615 splice site probably benign
IGL03395:Lrrc8c APN 5 105606629 missense probably benign
P0014:Lrrc8c UTSW 5 105607244 missense probably benign 0.06
PIT4504001:Lrrc8c UTSW 5 105608537 missense probably benign
PIT4651001:Lrrc8c UTSW 5 105608323 missense probably benign 0.04
R0196:Lrrc8c UTSW 5 105606770 missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105607099 missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105607028 missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105607678 missense probably damaging 0.99
R0722:Lrrc8c UTSW 5 105579548 missense probably damaging 1.00
R0815:Lrrc8c UTSW 5 105608534 missense probably damaging 1.00
R1177:Lrrc8c UTSW 5 105606836 missense probably benign 0.40
R1411:Lrrc8c UTSW 5 105608179 missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105607529 missense probably damaging 1.00
R1551:Lrrc8c UTSW 5 105608224 missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105606757 missense probably benign 0.22
R1714:Lrrc8c UTSW 5 105607291 missense possibly damaging 0.93
R1770:Lrrc8c UTSW 5 105606737 missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105607358 missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105606692 missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105607889 missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105608374 missense probably benign
R4897:Lrrc8c UTSW 5 105608089 missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105607127 missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105607483 missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105607687 missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105579557 missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105608251 missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105606746 missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R7271:Lrrc8c UTSW 5 105607987 missense probably benign 0.02
R7341:Lrrc8c UTSW 5 105607267 missense probably damaging 1.00
R7380:Lrrc8c UTSW 5 105607835 missense possibly damaging 0.71
R7630:Lrrc8c UTSW 5 105607702 missense probably damaging 0.99
R7789:Lrrc8c UTSW 5 105607200 missense probably damaging 1.00
R8128:Lrrc8c UTSW 5 105607622 missense probably damaging 1.00
R8229:Lrrc8c UTSW 5 105606536 missense probably benign 0.00
R8247:Lrrc8c UTSW 5 105608444 missense probably damaging 1.00
R8248:Lrrc8c UTSW 5 105607867 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCAACAAAATCAGATACCTGG -3'
(R):5'- AGAAGCATGTTTCAGTCATACTCTG -3'

Sequencing Primer
(F):5'- GATACCTGGACTTGTCCTATAACGAC -3'
(R):5'- GGCAGAGTCTCAAACAGA -3'
Posted On2018-04-02