Incidental Mutation 'R6304:Kdm2b'
ID509196
Institutional Source Beutler Lab
Gene Symbol Kdm2b
Ensembl Gene ENSMUSG00000029475
Gene Namelysine (K)-specific demethylase 2B
SynonymsJhdm1b, Fbxl10, Cxxc2
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location122870665-122989823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122881744 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 260 (S260P)
Ref Sequence ENSEMBL: ENSMUSP00000031435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031435] [ENSMUST00000046073] [ENSMUST00000086200] [ENSMUST00000118027] [ENSMUST00000121739] [ENSMUST00000127403] [ENSMUST00000152872]
Predicted Effect probably benign
Transcript: ENSMUST00000031435
AA Change: S260P

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031435
Gene: ENSMUSG00000029475
AA Change: S260P

DomainStartEndE-ValueType
Pfam:zf-CXXC 45 91 1.6e-17 PFAM
PHD 101 163 8.58e-4 SMART
low complexity region 259 290 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
FBOX 505 545 1.69e-2 SMART
LRR 588 610 1.31e2 SMART
LRR 612 637 2.9e2 SMART
LRR 652 676 2.04e2 SMART
LRR 677 702 1.1e1 SMART
LRR 732 757 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046073
AA Change: S793P

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038229
Gene: ENSMUSG00000029475
AA Change: S793P

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 1e-17 PDB
Pfam:zf-CXXC 578 624 3e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 792 823 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 990 1006 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
FBOX 1038 1078 1.69e-2 SMART
LRR 1121 1143 1.31e2 SMART
LRR 1145 1170 2.9e2 SMART
LRR 1185 1209 2.04e2 SMART
LRR 1210 1235 1.1e1 SMART
LRR 1265 1290 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086200
AA Change: S787P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083376
Gene: ENSMUSG00000029475
AA Change: S787P

DomainStartEndE-ValueType
Blast:JmjC 17 95 4e-41 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 540 1e-17 PDB
Pfam:zf-CXXC 572 618 2.1e-17 PFAM
PHD 628 690 8.58e-4 SMART
low complexity region 786 817 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 984 1000 N/A INTRINSIC
low complexity region 1012 1026 N/A INTRINSIC
FBOX 1032 1072 1.69e-2 SMART
LRR 1115 1137 1.31e2 SMART
LRR 1139 1164 2.9e2 SMART
LRR 1179 1203 2.04e2 SMART
LRR 1204 1229 1.1e1 SMART
LRR 1259 1284 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118027
SMART Domains Protein: ENSMUSP00000114052
Gene: ENSMUSG00000029475

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 9e-18 PDB
Pfam:zf-CXXC 578 624 2.1e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 865 875 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
FBOX 1000 1040 1.69e-2 SMART
LRR 1083 1105 1.31e2 SMART
LRR 1107 1132 2.9e2 SMART
LRR 1147 1171 2.04e2 SMART
LRR 1172 1197 1.1e1 SMART
LRR 1227 1252 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121739
AA Change: S738P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114049
Gene: ENSMUSG00000029475
AA Change: S738P

DomainStartEndE-ValueType
Blast:JmjC 1 46 2e-19 BLAST
JmjC 92 260 3.61e-41 SMART
low complexity region 325 346 N/A INTRINSIC
low complexity region 351 369 N/A INTRINSIC
PDB:2YU2|A 417 491 1e-17 PDB
Pfam:zf-CXXC 523 569 5.4e-17 PFAM
PHD 579 641 8.58e-4 SMART
low complexity region 737 768 N/A INTRINSIC
low complexity region 848 858 N/A INTRINSIC
low complexity region 935 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
FBOX 983 1023 1.69e-2 SMART
LRR 1066 1088 1.31e2 SMART
LRR 1090 1115 2.9e2 SMART
LRR 1130 1154 2.04e2 SMART
LRR 1155 1180 1.1e1 SMART
LRR 1210 1235 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139674
Predicted Effect probably benign
Transcript: ENSMUST00000152872
SMART Domains Protein: ENSMUSP00000119746
Gene: ENSMUSG00000029475

DomainStartEndE-ValueType
PHD 25 87 8.58e-4 SMART
low complexity region 243 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174357
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a H3K36-specific histone demethylase, which contains an N-terminal jumonji C domain, a CxxC zinc finger domain, a plant homeodomain finger, an F-box, and eight leucine-rich repeats. Amongst its demonstrated functions, this protein plays roles in the suppression of premature cellular senescence, leukemia maintenance and development, maintenance of mouse embryonic stem cell pluripotency, and induced pluripotent stem cell generation. Mice homozygous for a targeted deletion of the zinc finger domain display embryonic lethality with development ceasing at approximately 7 to 8 days post coitum, demonstrating an essential role in early development. A pseudogene of this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted allele that does not express the long form protein exhibit exencephaly, fetal and postnatal lethality, coloboma, curly tail, oligozoospermia, increased apoptosis, and increased neuronal precursor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Kdm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Kdm2b APN 5 122961567 missense probably damaging 1.00
IGL02061:Kdm2b APN 5 122883341 missense probably damaging 1.00
IGL02142:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02143:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02147:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02294:Kdm2b APN 5 122961474 missense probably damaging 1.00
IGL02309:Kdm2b APN 5 122947820 missense probably damaging 0.99
IGL03039:Kdm2b APN 5 122881671 missense probably benign 0.06
IGL03134:Kdm2b UTSW 5 122932674 missense probably damaging 1.00
PIT4520001:Kdm2b UTSW 5 122941047 missense probably damaging 1.00
R0008:Kdm2b UTSW 5 122881743 missense probably benign 0.08
R0592:Kdm2b UTSW 5 122961134 splice site probably benign
R0894:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R1078:Kdm2b UTSW 5 122961541 missense possibly damaging 0.83
R1387:Kdm2b UTSW 5 122880268 missense probably damaging 1.00
R1441:Kdm2b UTSW 5 122932880 missense probably benign 0.25
R1550:Kdm2b UTSW 5 122881057 missense probably damaging 1.00
R1795:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R2060:Kdm2b UTSW 5 122883365 missense probably damaging 1.00
R2161:Kdm2b UTSW 5 122880699 missense probably damaging 1.00
R2259:Kdm2b UTSW 5 122882416 missense probably damaging 1.00
R3843:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3844:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3859:Kdm2b UTSW 5 122880227 missense probably damaging 1.00
R4506:Kdm2b UTSW 5 122888625 missense possibly damaging 0.58
R4680:Kdm2b UTSW 5 122934786 missense probably damaging 0.99
R4786:Kdm2b UTSW 5 122880854 critical splice acceptor site probably null
R4894:Kdm2b UTSW 5 122940967 nonsense probably null
R5265:Kdm2b UTSW 5 122878588 missense probably damaging 1.00
R5522:Kdm2b UTSW 5 122949162 missense probably damaging 1.00
R5746:Kdm2b UTSW 5 122879364 missense probably damaging 1.00
R5813:Kdm2b UTSW 5 122871868 missense probably benign 0.37
R5920:Kdm2b UTSW 5 122880296 missense probably damaging 1.00
R5961:Kdm2b UTSW 5 122932661 missense probably benign 0.37
R6029:Kdm2b UTSW 5 122879587 missense probably damaging 1.00
R6280:Kdm2b UTSW 5 122878624 missense probably damaging 1.00
R6303:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6383:Kdm2b UTSW 5 122934778 missense probably damaging 1.00
R6432:Kdm2b UTSW 5 122880191 missense probably damaging 1.00
R6513:Kdm2b UTSW 5 122880239 missense probably damaging 0.99
R6526:Kdm2b UTSW 5 122961469 missense probably damaging 1.00
R7213:Kdm2b UTSW 5 122921469 missense probably damaging 0.99
R7226:Kdm2b UTSW 5 122921449 missense possibly damaging 0.60
R7292:Kdm2b UTSW 5 122880791 missense probably damaging 0.98
R7893:Kdm2b UTSW 5 122947739 missense probably benign 0.12
R8021:Kdm2b UTSW 5 122932919 missense probably damaging 0.99
R8038:Kdm2b UTSW 5 122960895 intron probably benign
R8162:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R8397:Kdm2b UTSW 5 122880516 missense probably benign 0.03
R8411:Kdm2b UTSW 5 122880176 missense probably damaging 1.00
Z1177:Kdm2b UTSW 5 122880797 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAATGGCCAAGGGTACTG -3'
(R):5'- TGATGATGTGCACCTGAGGAG -3'

Sequencing Primer
(F):5'- TACTGGGGAGTGGAGCCG -3'
(R):5'- AGCCCCAAGAGCTGAGTG -3'
Posted On2018-04-02