Incidental Mutation 'R6304:Osbpl3'
ID509198
Institutional Source Beutler Lab
Gene Symbol Osbpl3
Ensembl Gene ENSMUSG00000029822
Gene Nameoxysterol binding protein-like 3
Synonyms6720421I08Rik, OSBP3, ORP3, 1200014M06Rik
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location50293330-50456201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50312674 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 604 (S604P)
Ref Sequence ENSEMBL: ENSMUSP00000110112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071728] [ENSMUST00000090019] [ENSMUST00000114466] [ENSMUST00000114468]
Predicted Effect probably damaging
Transcript: ENSMUST00000071728
AA Change: S568P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071643
Gene: ENSMUSG00000029822
AA Change: S568P

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 392 425 N/A INTRINSIC
Pfam:Oxysterol_BP 459 804 3.2e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090019
AA Change: S635P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087473
Gene: ENSMUSG00000029822
AA Change: S635P

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 4e-25 BLAST
low complexity region 459 492 N/A INTRINSIC
Pfam:Oxysterol_BP 526 870 3e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114466
AA Change: S599P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110110
Gene: ENSMUSG00000029822
AA Change: S599P

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 3e-25 BLAST
low complexity region 423 456 N/A INTRINSIC
Pfam:Oxysterol_BP 490 835 3.5e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114468
AA Change: S604P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110112
Gene: ENSMUSG00000029822
AA Change: S604P

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 428 461 N/A INTRINSIC
Pfam:Oxysterol_BP 495 840 1.3e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133141
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. The encoded protein is involved in the regulation of cell adhesion and organization of the actin cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Osbpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Osbpl3 APN 6 50323068 missense probably damaging 1.00
IGL01784:Osbpl3 APN 6 50344922 missense probably damaging 1.00
IGL02221:Osbpl3 APN 6 50327367 unclassified probably benign
IGL02323:Osbpl3 APN 6 50346326 critical splice donor site probably null
IGL02894:Osbpl3 APN 6 50346332 missense possibly damaging 0.89
H8562:Osbpl3 UTSW 6 50347466 missense probably benign 0.09
PIT4283001:Osbpl3 UTSW 6 50346088 missense probably benign 0.01
R0226:Osbpl3 UTSW 6 50353008 missense probably damaging 1.00
R0416:Osbpl3 UTSW 6 50348018 missense probably benign
R0417:Osbpl3 UTSW 6 50348018 missense probably benign
R0601:Osbpl3 UTSW 6 50299403 missense probably benign 0.05
R0826:Osbpl3 UTSW 6 50346377 missense probably damaging 1.00
R1390:Osbpl3 UTSW 6 50308427 missense probably damaging 1.00
R1520:Osbpl3 UTSW 6 50346431 missense possibly damaging 0.75
R1603:Osbpl3 UTSW 6 50323093 missense probably damaging 1.00
R1678:Osbpl3 UTSW 6 50336213 critical splice donor site probably null
R1843:Osbpl3 UTSW 6 50370143 missense probably damaging 1.00
R1943:Osbpl3 UTSW 6 50320074 missense probably benign 0.16
R3435:Osbpl3 UTSW 6 50348070 missense possibly damaging 0.94
R3768:Osbpl3 UTSW 6 50348002 missense possibly damaging 0.64
R4746:Osbpl3 UTSW 6 50328674 missense probably damaging 0.99
R4751:Osbpl3 UTSW 6 50300997 missense possibly damaging 0.95
R4776:Osbpl3 UTSW 6 50300973 missense probably benign 0.01
R4814:Osbpl3 UTSW 6 50353000 missense probably damaging 1.00
R4841:Osbpl3 UTSW 6 50309376 missense probably damaging 1.00
R4881:Osbpl3 UTSW 6 50352784 missense possibly damaging 0.95
R4999:Osbpl3 UTSW 6 50336297 missense probably damaging 0.99
R5512:Osbpl3 UTSW 6 50309360 missense probably damaging 0.98
R6282:Osbpl3 UTSW 6 50348083 splice site probably null
R6905:Osbpl3 UTSW 6 50351882 missense probably damaging 1.00
R7000:Osbpl3 UTSW 6 50297157 missense probably damaging 1.00
R7102:Osbpl3 UTSW 6 50320135 missense probably damaging 1.00
R7275:Osbpl3 UTSW 6 50346430 missense probably benign 0.02
R7334:Osbpl3 UTSW 6 50344906 missense possibly damaging 0.78
R7368:Osbpl3 UTSW 6 50348098 missense probably damaging 1.00
R8052:Osbpl3 UTSW 6 50346015 missense probably damaging 1.00
R8183:Osbpl3 UTSW 6 50303109 missense probably benign 0.00
RF011:Osbpl3 UTSW 6 50348138 critical splice acceptor site probably benign
Z1088:Osbpl3 UTSW 6 50297097 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACCCATTTGCTGCCTACC -3'
(R):5'- GCTGGCTATGTCAAGAGTGC -3'

Sequencing Primer
(F):5'- TACCCTCTGCTAAAAAGCTGGG -3'
(R):5'- TATGTCAAGAGTGCCCCCTAGAG -3'
Posted On2018-04-02