Incidental Mutation 'R6304:Olfr639'
ID509200
Institutional Source Beutler Lab
Gene Symbol Olfr639
Ensembl Gene ENSMUSG00000066263
Gene Nameolfactory receptor 639
SynonymsMOR12-1, GA_x6K02T2PBJ9-6747143-6746193
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104006231-104017303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104012031 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 224 (L224F)
Ref Sequence ENSEMBL: ENSMUSP00000149743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106862] [ENSMUST00000138055] [ENSMUST00000215653]
Predicted Effect probably damaging
Transcript: ENSMUST00000106862
AA Change: L224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102475
Gene: ENSMUSG00000066263
AA Change: L224F

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.4e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 173 3.6e-9 PFAM
Pfam:7tm_1 43 294 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215653
AA Change: L224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Olfr639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr639 APN 7 104012114 missense probably damaging 1.00
IGL01547:Olfr639 APN 7 104012660 missense probably benign 0.43
IGL02173:Olfr639 APN 7 104011830 missense probably damaging 1.00
IGL02707:Olfr639 APN 7 104012402 missense probably damaging 1.00
IGL03124:Olfr639 APN 7 104011794 missense probably benign
R0004:Olfr639 UTSW 7 104012431 missense probably benign 0.02
R0086:Olfr639 UTSW 7 104012054 missense probably benign 0.23
R0370:Olfr639 UTSW 7 104012059 missense probably damaging 0.99
R0599:Olfr639 UTSW 7 104012188 nonsense probably null
R1351:Olfr639 UTSW 7 104012316 missense possibly damaging 0.81
R1604:Olfr639 UTSW 7 104011955 missense probably damaging 1.00
R2314:Olfr639 UTSW 7 104012229 missense probably benign 0.09
R2656:Olfr639 UTSW 7 104011865 missense probably damaging 0.96
R4594:Olfr639 UTSW 7 104012417 missense probably benign 0.01
R4774:Olfr639 UTSW 7 104012588 missense probably benign 0.00
R4945:Olfr639 UTSW 7 104012378 missense possibly damaging 0.85
R4968:Olfr639 UTSW 7 104012570 missense probably damaging 1.00
R4981:Olfr639 UTSW 7 104012105 missense probably damaging 0.97
R5072:Olfr639 UTSW 7 104012118 missense probably damaging 0.97
R5982:Olfr639 UTSW 7 104011910 missense probably damaging 1.00
R6303:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6332:Olfr639 UTSW 7 104011773 missense probably benign 0.00
R7107:Olfr639 UTSW 7 104012282 missense probably benign 0.16
R7152:Olfr639 UTSW 7 104012019 missense probably benign
R7456:Olfr639 UTSW 7 104011838 missense possibly damaging 0.83
R7849:Olfr639 UTSW 7 104012303 missense possibly damaging 0.56
R8023:Olfr639 UTSW 7 104011799 missense probably damaging 0.97
R8082:Olfr639 UTSW 7 104012690 missense probably benign 0.04
R8215:Olfr639 UTSW 7 104012123 missense possibly damaging 0.85
Z1177:Olfr639 UTSW 7 104012150 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCGACATAAGTGTGTGGACC -3'
(R):5'- CCATGGGTCTGGGTATTACAC -3'

Sequencing Primer
(F):5'- ACCACTGGTGATGCATGC -3'
(R):5'- CCATGGGTCTGGGTATTACACTAAAG -3'
Posted On2018-04-02