Incidental Mutation 'R6304:Sesn3'
ID509202
Institutional Source Beutler Lab
Gene Symbol Sesn3
Ensembl Gene ENSMUSG00000032009
Gene Namesestrin 3
Synonyms5630400E15Rik, SEST3
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location14275067-14333101 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 14322561 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034507] [ENSMUST00000208222] [ENSMUST00000209187]
Predicted Effect probably null
Transcript: ENSMUST00000034507
SMART Domains Protein: ENSMUSP00000034507
Gene: ENSMUSG00000032009

DomainStartEndE-ValueType
low complexity region 6 12 N/A INTRINSIC
Pfam:PA26 39 491 8.4e-204 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208142
Predicted Effect probably null
Transcript: ENSMUST00000208222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209145
Predicted Effect probably null
Transcript: ENSMUST00000209187
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: When fed a high fat diet, mice homozygous for a gene trap allele exhibit impaired glucose tolerance, insulin resistance, reduced hepatic glucose production, impaired adipocyte glucose uptake, increased hepatic steatosis, and decreased mitochondria in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Sesn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Sesn3 APN 9 14321142 missense probably damaging 1.00
IGL01396:Sesn3 APN 9 14321078 missense probably benign 0.43
IGL01925:Sesn3 APN 9 14320400 missense probably damaging 1.00
IGL02016:Sesn3 APN 9 14320337 missense probably damaging 1.00
IGL02498:Sesn3 APN 9 14306268 splice site probably benign
IGL02892:Sesn3 APN 9 14314734 critical splice donor site probably null
IGL02933:Sesn3 APN 9 14321208 missense probably damaging 1.00
IGL03112:Sesn3 APN 9 14310261 missense probably damaging 1.00
R0591:Sesn3 UTSW 9 14308558 missense probably damaging 0.96
R1450:Sesn3 UTSW 9 14316224 missense possibly damaging 0.80
R1495:Sesn3 UTSW 9 14308521 missense probably damaging 0.98
R1897:Sesn3 UTSW 9 14308645 missense probably damaging 1.00
R2237:Sesn3 UTSW 9 14308465 missense probably benign
R2238:Sesn3 UTSW 9 14308465 missense probably benign
R4209:Sesn3 UTSW 9 14306209 missense probably benign 0.12
R4352:Sesn3 UTSW 9 14320373 missense probably damaging 0.99
R4535:Sesn3 UTSW 9 14322658 missense probably benign 0.05
R4572:Sesn3 UTSW 9 14321220 missense probably benign 0.03
R6261:Sesn3 UTSW 9 14321163 missense probably benign 0.27
R6556:Sesn3 UTSW 9 14321253 missense possibly damaging 0.95
R6741:Sesn3 UTSW 9 14320340 missense possibly damaging 0.72
R6906:Sesn3 UTSW 9 14325641 missense probably damaging 0.98
R6988:Sesn3 UTSW 9 14310257 nonsense probably null
R7289:Sesn3 UTSW 9 14276552 start codon destroyed probably benign
R7318:Sesn3 UTSW 9 14308577 missense probably damaging 0.96
R7646:Sesn3 UTSW 9 14308615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGTTAGACTCAGATTTTCACC -3'
(R):5'- GGTCTGCTTGGTAATGACACTG -3'

Sequencing Primer
(F):5'- AGTGCTTCTCTCAGAGAACGC -3'
(R):5'- GGTAATGACACTGACCTTCTCTGAG -3'
Posted On2018-04-02