Incidental Mutation 'R6304:Phyhipl'
ID509204
Institutional Source Beutler Lab
Gene Symbol Phyhipl
Ensembl Gene ENSMUSG00000037747
Gene Namephytanoyl-CoA hydroxylase interacting protein-like
Synonyms
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location70557682-70655965 bp(-) (GRCm38)
Type of Mutationsplice site (821 bp from exon)
DNA Base Change (assembly) A to G at 70559557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046513] [ENSMUST00000062883] [ENSMUST00000105436] [ENSMUST00000162251] [ENSMUST00000173042]
Predicted Effect probably damaging
Transcript: ENSMUST00000046513
AA Change: M273T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045807
Gene: ENSMUSG00000037747
AA Change: M273T

DomainStartEndE-ValueType
FN3 49 142 6.16e-2 SMART
Blast:FN3 188 262 2e-45 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000062883
SMART Domains Protein: ENSMUSP00000051375
Gene: ENSMUSG00000043259

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 529 557 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105436
SMART Domains Protein: ENSMUSP00000101076
Gene: ENSMUSG00000043259

DomainStartEndE-ValueType
low complexity region 118 140 N/A INTRINSIC
low complexity region 192 212 N/A INTRINSIC
coiled coil region 222 290 N/A INTRINSIC
coiled coil region 447 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162144
SMART Domains Protein: ENSMUSP00000124828
Gene: ENSMUSG00000037747

DomainStartEndE-ValueType
FN3 37 130 6.16e-2 SMART
Blast:FN3 176 212 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162251
AA Change: M228T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125179
Gene: ENSMUSG00000037747
AA Change: M228T

DomainStartEndE-ValueType
FN3 4 97 6.16e-2 SMART
Blast:FN3 143 217 9e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162470
Predicted Effect probably null
Transcript: ENSMUST00000173042
SMART Domains Protein: ENSMUSP00000134648
Gene: ENSMUSG00000043259

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 528 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219514
Meta Mutation Damage Score 0.1134 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Phyhipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Phyhipl APN 10 70570830 missense probably damaging 1.00
IGL03374:Phyhipl APN 10 70565279 missense possibly damaging 0.47
PIT4366001:Phyhipl UTSW 10 70568958 missense probably benign
R0512:Phyhipl UTSW 10 70568918 missense probably damaging 0.99
R0688:Phyhipl UTSW 10 70559255 missense probably damaging 1.00
R1136:Phyhipl UTSW 10 70569072 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1802:Phyhipl UTSW 10 70599025 missense probably benign
R1978:Phyhipl UTSW 10 70559761 missense possibly damaging 0.94
R4077:Phyhipl UTSW 10 70569073 missense probably damaging 1.00
R4960:Phyhipl UTSW 10 70568985 missense probably benign 0.40
R4976:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5119:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5739:Phyhipl UTSW 10 70559569 missense possibly damaging 0.92
R6303:Phyhipl UTSW 10 70559557 splice site probably null
R6649:Phyhipl UTSW 10 70569013 missense probably damaging 1.00
X0022:Phyhipl UTSW 10 70568961 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACAGGGTCAGTGTAAATGAC -3'
(R):5'- GCTATGCAGCCTTCCATCAAG -3'

Sequencing Primer
(F):5'- GACTTCTAAAATGACATCCTGGGCG -3'
(R):5'- TCCATCAAGGATAACAGTGGTAGCC -3'
Posted On2018-04-02