Incidental Mutation 'R6304:Etaa1'
ID509206
Institutional Source Beutler Lab
Gene Symbol Etaa1
Ensembl Gene ENSMUSG00000016984
Gene NameEwing tumor-associated antigen 1
Synonyms5730466H23Rik
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location17938756-17953875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17947505 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 204 (M204R)
Ref Sequence ENSEMBL: ENSMUSP00000075957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076661]
Predicted Effect probably damaging
Transcript: ENSMUST00000076661
AA Change: M204R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075957
Gene: ENSMUSG00000016984
AA Change: M204R

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ETAA1 79 865 N/A PFAM
Meta Mutation Damage Score 0.1943 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Etaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Etaa1 APN 11 17947825 nonsense probably null
IGL00555:Etaa1 APN 11 17947535 missense probably damaging 1.00
IGL01098:Etaa1 APN 11 17946059 missense probably damaging 0.99
IGL01100:Etaa1 APN 11 17952576 critical splice donor site probably null
IGL01312:Etaa1 APN 11 17945909 missense probably damaging 1.00
IGL01391:Etaa1 APN 11 17946005 missense probably damaging 1.00
IGL01607:Etaa1 APN 11 17953637 missense probably benign 0.00
IGL02066:Etaa1 APN 11 17946687 missense probably benign
R0401:Etaa1 UTSW 11 17947514 missense probably damaging 1.00
R0413:Etaa1 UTSW 11 17946350 nonsense probably null
R0790:Etaa1 UTSW 11 17946051 missense probably benign 0.00
R1442:Etaa1 UTSW 11 17947201 missense probably benign 0.19
R1447:Etaa1 UTSW 11 17946625 missense possibly damaging 0.92
R1647:Etaa1 UTSW 11 17946492 missense probably damaging 0.99
R1945:Etaa1 UTSW 11 17947233 missense probably damaging 0.96
R1996:Etaa1 UTSW 11 17952671 missense probably damaging 1.00
R2211:Etaa1 UTSW 11 17952686 nonsense probably null
R2338:Etaa1 UTSW 11 17945605 critical splice donor site probably null
R3027:Etaa1 UTSW 11 17947886 missense probably damaging 1.00
R3546:Etaa1 UTSW 11 17953823 start gained probably benign
R4118:Etaa1 UTSW 11 17946180 missense probably benign 0.18
R4156:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
R4657:Etaa1 UTSW 11 17946964 missense possibly damaging 0.81
R4882:Etaa1 UTSW 11 17946174 missense probably benign 0.10
R4914:Etaa1 UTSW 11 17946532 missense probably benign 0.05
R4978:Etaa1 UTSW 11 17946581 missense probably damaging 0.99
R5202:Etaa1 UTSW 11 17947853 missense probably damaging 1.00
R5384:Etaa1 UTSW 11 17947539 missense probably damaging 1.00
R5584:Etaa1 UTSW 11 17947406 missense possibly damaging 0.72
R6303:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6351:Etaa1 UTSW 11 17947188 missense possibly damaging 0.95
R6391:Etaa1 UTSW 11 17946833 missense probably benign 0.04
R6685:Etaa1 UTSW 11 17953582 missense probably benign 0.40
R6705:Etaa1 UTSW 11 17945639 missense probably benign 0.02
R6807:Etaa1 UTSW 11 17952680 missense probably benign
R6863:Etaa1 UTSW 11 17953794 start codon destroyed probably benign 0.01
R6985:Etaa1 UTSW 11 17946108 missense probably damaging 0.99
R7129:Etaa1 UTSW 11 17940339 missense possibly damaging 0.92
R7429:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
Z1088:Etaa1 UTSW 11 17946465 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGTCTTGTGCCTTTGCCAAG -3'
(R):5'- TCCTGAAAGTCAGTGAGGCAG -3'

Sequencing Primer
(F):5'- GCCAAGGATATTCTACTGTCTCC -3'
(R):5'- AGGCGCTCCATTCTTGCTCATAG -3'
Posted On2018-04-02