Incidental Mutation 'R6304:G6pc'
ID509208
Institutional Source Beutler Lab
Gene Symbol G6pc
Ensembl Gene ENSMUSG00000078650
Gene Nameglucose-6-phosphatase, catalytic
SynonymsGlc-6-Pase, G6Pase, G6pt, Glc-6-Pase-alpha
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101367561-101377903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101367909 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 38 (D38G)
Ref Sequence ENSEMBL: ENSMUSP00000019469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019469]
Predicted Effect probably damaging
Transcript: ENSMUST00000019469
AA Change: D38G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019469
Gene: ENSMUSG00000078650
AA Change: D38G

DomainStartEndE-ValueType
acidPPc 56 196 2.28e-40 SMART
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 256 278 N/A INTRINSIC
transmembrane domain 291 308 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: The enzyme encoded by this gene is a multisubunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for glucose-6-phosphate, inorganic phosphate, and glucose. This gene is one of three glucose-6-phosphatase catalytic-subunit-encoding genes in mouse. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene tend to die within a couple of weeks of weaning. Blood chemistry and glucose metabolism are abnormal as is glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in G6pc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:G6pc APN 11 101370723 missense probably damaging 1.00
IGL03068:G6pc APN 11 101370750 missense probably benign 0.01
R1988:G6pc UTSW 11 101367942 missense probably damaging 0.97
R3936:G6pc UTSW 11 101374603 missense probably benign
R4601:G6pc UTSW 11 101372741 missense probably damaging 1.00
R4677:G6pc UTSW 11 101376613 missense probably benign
R6073:G6pc UTSW 11 101367976 missense probably benign
R7103:G6pc UTSW 11 101374587 splice site probably null
R7143:G6pc UTSW 11 101370723 missense probably damaging 1.00
R7438:G6pc UTSW 11 101376677 missense probably benign 0.17
R7499:G6pc UTSW 11 101376694 nonsense probably null
R7960:G6pc UTSW 11 101376533 missense probably damaging 1.00
R8339:G6pc UTSW 11 101376488 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCAAGGCACAGACTGATAGC -3'
(R):5'- CCTGGTGAACAGTATGGGGTAC -3'

Sequencing Primer
(F):5'- GATCAAGGCCAACCGGG -3'
(R):5'- TACCCCTGCTGGAGGACAG -3'
Posted On2018-04-02