Incidental Mutation 'R6304:Bin3'
ID509212
Institutional Source Beutler Lab
Gene Symbol Bin3
Ensembl Gene ENSMUSG00000022089
Gene Namebridging integrator 3
Synonyms
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70100105-70138206 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70137176 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 218 (D218G)
Ref Sequence ENSEMBL: ENSMUSP00000022680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022680] [ENSMUST00000035612]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022680
AA Change: D218G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022680
Gene: ENSMUSG00000022089
AA Change: D218G

DomainStartEndE-ValueType
BAR 5 225 2.05e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035612
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228049
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the BAR domain protein family. The encoded protein is comprised solely of a BAR domain which is predicted to form coiled-coil structures and proposed to mediate dimerization, sense and induce membrane curvature, and bind small GTPases. BAR domain proteins have been implicated in endocytosis, intracellular transport, and a diverse set of other processes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop juvenile cataracts characterized by defects in cytoskeletal filamentous actin organization, show a higher incidence of spontaneous lymphomas during aging, and display a greater sensitivity to lung adenocarcinoma formation in response to radiation or carcinogen treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Bin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Bin3 APN 14 70134826 missense possibly damaging 0.67
IGL02311:Bin3 APN 14 70124217 missense probably benign 0.00
IGL02871:Bin3 APN 14 70128905 nonsense probably null
R0504:Bin3 UTSW 14 70123887 splice site probably null
R1564:Bin3 UTSW 14 70134769 missense probably damaging 0.97
R2012:Bin3 UTSW 14 70134773 missense probably damaging 1.00
R4328:Bin3 UTSW 14 70118605 missense probably benign 0.03
R4711:Bin3 UTSW 14 70128839 splice site probably null
R4857:Bin3 UTSW 14 70128895 missense probably benign 0.29
R5318:Bin3 UTSW 14 70134512 missense possibly damaging 0.89
R6269:Bin3 UTSW 14 70137162 missense probably benign
R6303:Bin3 UTSW 14 70137176 missense possibly damaging 0.90
R6345:Bin3 UTSW 14 70137227 missense probably benign
R7365:Bin3 UTSW 14 70134527 missense probably damaging 1.00
R8429:Bin3 UTSW 14 70137149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGACTGCTGAGGGATAGATAG -3'
(R):5'- CATGAATCCATGCCCGCTAG -3'

Sequencing Primer
(F):5'- TCTAAGAGGCAGTGATGGAAC -3'
(R):5'- CCGCTAGGAGCAAAGCCTATAG -3'
Posted On2018-04-02