Incidental Mutation 'R6304:Gramd4'
ID509215
Institutional Source Beutler Lab
Gene Symbol Gramd4
Ensembl Gene ENSMUSG00000035900
Gene NameGRAM domain containing 4
Synonyms
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location86057695-86137634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86134919 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 596 (E596G)
Ref Sequence ENSEMBL: ENSMUSP00000120796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044332] [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]
Predicted Effect probably benign
Transcript: ENSMUST00000044332
SMART Domains Protein: ENSMUSP00000038203
Gene: ENSMUSG00000035891

DomainStartEndE-ValueType
Blast:PH 8 126 9e-39 BLAST
Pfam:DAGK_cat 132 274 1.1e-31 PFAM
low complexity region 356 367 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000088931
SMART Domains Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 132 190 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
GRAM 500 578 8.41e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123349
SMART Domains Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138134
AA Change: E596G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900
AA Change: E596G

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150767
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Gramd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Gramd4 APN 15 86127018 missense probably damaging 0.97
Grasping UTSW 15 86091503 missense probably damaging 0.99
R0053:Gramd4 UTSW 15 86130138 splice site probably benign
R0622:Gramd4 UTSW 15 86091389 missense probably damaging 1.00
R1401:Gramd4 UTSW 15 86125196 missense probably damaging 1.00
R1741:Gramd4 UTSW 15 86091529 splice site probably null
R1840:Gramd4 UTSW 15 86130192 critical splice donor site probably null
R1968:Gramd4 UTSW 15 86132905 missense probably damaging 1.00
R2909:Gramd4 UTSW 15 86122183 nonsense probably null
R4345:Gramd4 UTSW 15 86134893 missense probably damaging 1.00
R4431:Gramd4 UTSW 15 86130160 missense probably damaging 1.00
R4832:Gramd4 UTSW 15 86134856 missense probably benign
R5164:Gramd4 UTSW 15 86100831 missense probably benign 0.16
R5216:Gramd4 UTSW 15 86134785 critical splice acceptor site probably null
R5898:Gramd4 UTSW 15 86100784 missense probably damaging 1.00
R5959:Gramd4 UTSW 15 86127557 missense probably damaging 0.99
R6303:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6678:Gramd4 UTSW 15 86091503 missense probably damaging 0.99
R6678:Gramd4 UTSW 15 86091504 missense possibly damaging 0.52
R6980:Gramd4 UTSW 15 86131969 missense probably benign 0.17
R7371:Gramd4 UTSW 15 86135406 missense probably benign 0.04
R7557:Gramd4 UTSW 15 86100900 nonsense probably null
R7922:Gramd4 UTSW 15 86131958 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTGTCCTTGTACCTGACCTGTAG -3'
(R):5'- CTGGGCCTCCTGTAACTGTATG -3'

Sequencing Primer
(F):5'- ACCTGACCTGTAGGAGTGTATC -3'
(R):5'- TGTAACTGTATGGCGCCCAC -3'
Posted On2018-04-02