Incidental Mutation 'R6304:Sh3gl1'
ID509218
Institutional Source Beutler Lab
Gene Symbol Sh3gl1
Ensembl Gene ENSMUSG00000003200
Gene NameSH3-domain GRB2-like 1
SynonymsSh3d2b, SH3P8, endophilin II, EEN
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6304 (G1)
Quality Score199.009
Status Not validated
Chromosome17
Chromosomal Location56016753-56036637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56036431 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 10 (F10Y)
Ref Sequence ENSEMBL: ENSMUSP00000003268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002914] [ENSMUST00000003268]
Predicted Effect probably benign
Transcript: ENSMUST00000002914
SMART Domains Protein: ENSMUSP00000002914
Gene: ENSMUSG00000002835

DomainStartEndE-ValueType
Pfam:CAF1-p150_N 1 210 3.8e-59 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:CAF-1_p150 299 458 1e-49 PFAM
low complexity region 466 481 N/A INTRINSIC
Pfam:CAF1A 537 611 1.1e-25 PFAM
Pfam:CAF1-p150_C2 644 908 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003268
AA Change: F10Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000003268
Gene: ENSMUSG00000003200
AA Change: F10Y

DomainStartEndE-ValueType
BAR 5 242 1.05e-98 SMART
low complexity region 250 264 N/A INTRINSIC
SH3 309 364 7.62e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal life span and no obvious phenotypic defects. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmissionand abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pcdhb9 T A 18: 37,401,367 V138E probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Sh3gl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Sh3gl1 APN 17 56019325 missense possibly damaging 0.48
IGL02721:Sh3gl1 APN 17 56017577 missense possibly damaging 0.91
R0092:Sh3gl1 UTSW 17 56018088 missense probably benign 0.00
R0525:Sh3gl1 UTSW 17 56017873 missense probably benign 0.00
R3684:Sh3gl1 UTSW 17 56018953 missense possibly damaging 0.91
R3792:Sh3gl1 UTSW 17 56018949 missense probably damaging 1.00
R4282:Sh3gl1 UTSW 17 56036456 missense probably damaging 1.00
R4298:Sh3gl1 UTSW 17 56019173 missense probably damaging 1.00
R5868:Sh3gl1 UTSW 17 56019119 missense probably damaging 1.00
R6379:Sh3gl1 UTSW 17 56019143 missense probably damaging 1.00
R6523:Sh3gl1 UTSW 17 56017617 missense possibly damaging 0.84
R7146:Sh3gl1 UTSW 17 56017646 missense probably damaging 1.00
R7174:Sh3gl1 UTSW 17 56017846 missense probably benign 0.01
R7922:Sh3gl1 UTSW 17 56019438 missense probably damaging 1.00
R8248:Sh3gl1 UTSW 17 56019038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCATAGCCTGGAGACTTTGG -3'
(R):5'- TGCCATGTAATATCCCGGCC -3'

Sequencing Primer
(F):5'- CGAACTTACGTTGTAAAGCCTGGC -3'
(R):5'- TAATATCCCGGCCGCGCG -3'
Posted On2018-04-02