Incidental Mutation 'R6304:Pcdhb9'
ID509221
Institutional Source Beutler Lab
Gene Symbol Pcdhb9
Ensembl Gene ENSMUSG00000051242
Gene Nameprotocadherin beta 9
SynonymsPcdhbI, Pcdhb4C
MMRRC Submission 044380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6304 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37400855-37403909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37401367 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 138 (V138E)
Ref Sequence ENSEMBL: ENSMUSP00000058801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057228] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000057228
AA Change: V138E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058801
Gene: ENSMUSG00000051242
AA Change: V138E

DomainStartEndE-ValueType
Pfam:Cadherin_2 65 147 2.3e-33 PFAM
CA 190 275 1.28e-17 SMART
CA 299 380 7.6e-25 SMART
CA 403 484 5.81e-21 SMART
CA 508 594 9.8e-28 SMART
CA 624 705 1.86e-10 SMART
Pfam:Cadherin_C_2 722 805 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
5330417C22Rik A C 3: 108,461,256 C806W probably damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cbll1 A G 12: 31,494,589 probably null Het
Cped1 A T 6: 22,016,923 R90S probably benign Het
Csmd1 A T 8: 16,058,674 L1905Q probably damaging Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
G6pc A G 11: 101,367,909 D38G probably damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Igsf9b C T 9: 27,342,575 R1354W probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kcnh7 A T 2: 62,764,616 Y703* probably null Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Kdm6b G T 11: 69,404,258 T1061K unknown Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lpar1 T C 4: 58,487,013 Y86C probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Miip T C 4: 147,863,083 M207V probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Osbpl3 A G 6: 50,312,674 S604P probably damaging Het
Pcdhb6 C T 18: 37,335,921 R632* probably null Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Pomt1 T A 2: 32,250,790 L478Q probably damaging Het
Robo2 T A 16: 73,958,308 Y779F probably damaging Het
Sesn3 A T 9: 14,322,561 probably null Het
Sh3gl1 A T 17: 56,036,431 F10Y probably benign Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spsb1 C T 4: 149,906,731 V127I probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Ttn A T 2: 76,891,099 probably benign Het
Ttn G T 2: 76,915,735 probably benign Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Vmn2r51 T C 7: 10,098,237 Q474R probably benign Het
Wdr78 T C 4: 103,087,356 E266G probably benign Het
Other mutations in Pcdhb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pcdhb9 APN 18 37403279 missense possibly damaging 0.59
IGL01557:Pcdhb9 APN 18 37403047 missense probably damaging 1.00
IGL01716:Pcdhb9 APN 18 37403175 missense probably damaging 0.99
IGL01954:Pcdhb9 APN 18 37401741 missense probably damaging 1.00
IGL02063:Pcdhb9 APN 18 37401757 missense probably benign 0.21
IGL03057:Pcdhb9 APN 18 37401277 missense probably benign 0.00
R0140:Pcdhb9 UTSW 18 37402961 missense possibly damaging 0.89
R0180:Pcdhb9 UTSW 18 37402254 missense probably damaging 1.00
R0349:Pcdhb9 UTSW 18 37402579 missense probably damaging 0.99
R0616:Pcdhb9 UTSW 18 37401975 nonsense probably null
R0669:Pcdhb9 UTSW 18 37402255 missense probably damaging 1.00
R1256:Pcdhb9 UTSW 18 37403116 missense possibly damaging 0.94
R1642:Pcdhb9 UTSW 18 37400934 intron probably benign
R1678:Pcdhb9 UTSW 18 37401629 missense probably damaging 1.00
R1711:Pcdhb9 UTSW 18 37403327 nonsense probably null
R1762:Pcdhb9 UTSW 18 37403083 missense probably benign 0.00
R1823:Pcdhb9 UTSW 18 37402818 missense probably benign 0.14
R1868:Pcdhb9 UTSW 18 37402084 missense probably damaging 1.00
R1959:Pcdhb9 UTSW 18 37403316 missense probably damaging 1.00
R2446:Pcdhb9 UTSW 18 37403287 missense probably damaging 0.99
R2889:Pcdhb9 UTSW 18 37403223 missense probably benign 0.06
R2890:Pcdhb9 UTSW 18 37403326 missense probably benign 0.23
R3196:Pcdhb9 UTSW 18 37401610 missense probably benign 0.02
R3725:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R3726:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R4179:Pcdhb9 UTSW 18 37401115 missense probably benign 0.17
R4326:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4326:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4327:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4327:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4329:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4329:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4626:Pcdhb9 UTSW 18 37402249 missense probably benign 0.01
R4738:Pcdhb9 UTSW 18 37403415 missense probably benign 0.33
R4888:Pcdhb9 UTSW 18 37403233 missense probably benign 0.22
R5140:Pcdhb9 UTSW 18 37401133 missense probably benign 0.00
R5186:Pcdhb9 UTSW 18 37401232 missense probably damaging 1.00
R5502:Pcdhb9 UTSW 18 37401603 missense possibly damaging 0.95
R5586:Pcdhb9 UTSW 18 37401114 missense probably benign
R5601:Pcdhb9 UTSW 18 37402206 missense probably damaging 1.00
R5624:Pcdhb9 UTSW 18 37401406 missense probably benign
R5827:Pcdhb9 UTSW 18 37401958 missense possibly damaging 0.72
R5829:Pcdhb9 UTSW 18 37401889 missense probably damaging 0.97
R5837:Pcdhb9 UTSW 18 37402798 missense probably damaging 1.00
R6147:Pcdhb9 UTSW 18 37402441 missense possibly damaging 0.95
R6228:Pcdhb9 UTSW 18 37402062 missense probably benign 0.00
R6245:Pcdhb9 UTSW 18 37403154 missense probably damaging 1.00
R6542:Pcdhb9 UTSW 18 37401589 missense probably damaging 0.99
R6904:Pcdhb9 UTSW 18 37401917 missense probably benign 0.01
R7058:Pcdhb9 UTSW 18 37403281 missense probably benign 0.35
R7159:Pcdhb9 UTSW 18 37401492 missense possibly damaging 0.89
R7258:Pcdhb9 UTSW 18 37402114 missense probably damaging 1.00
R7800:Pcdhb9 UTSW 18 37401549 missense probably benign 0.01
R8027:Pcdhb9 UTSW 18 37403016 missense possibly damaging 0.81
R8141:Pcdhb9 UTSW 18 37402308 missense probably damaging 1.00
R8157:Pcdhb9 UTSW 18 37403155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGGCTCCTTTGTAGCCC -3'
(R):5'- CTGACTGTGTATTGTTGAAGCC -3'

Sequencing Primer
(F):5'- CCTTTGTAGCCCACCTGG -3'
(R):5'- ACTGTGTATTGTTGAAGCCCATTGC -3'
Posted On2018-04-02