Incidental Mutation 'R6288:Crocc2'
ID509224
Institutional Source Beutler Lab
Gene Symbol Crocc2
Ensembl Gene ENSMUSG00000084989
Gene Nameciliary rootlet coiled-coil, rootletin family member 2
SynonymsLOC381284, E030010N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93168725-93231072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93194505 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 707 (R707G)
Ref Sequence ENSEMBL: ENSMUSP00000120588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138595]
Predicted Effect probably benign
Transcript: ENSMUST00000138595
AA Change: R707G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120588
Gene: ENSMUSG00000084989
AA Change: R707G

DomainStartEndE-ValueType
low complexity region 67 82 N/A INTRINSIC
Pfam:Rootletin 89 260 5.1e-24 PFAM
coiled coil region 281 346 N/A INTRINSIC
internal_repeat_1 381 424 9.68e-9 PROSPERO
internal_repeat_3 389 414 5.46e-6 PROSPERO
internal_repeat_4 398 425 1.1e-5 PROSPERO
coiled coil region 426 627 N/A INTRINSIC
coiled coil region 655 1247 N/A INTRINSIC
internal_repeat_2 1252 1280 6.61e-7 PROSPERO
internal_repeat_4 1341 1374 1.1e-5 PROSPERO
internal_repeat_1 1347 1384 9.68e-9 PROSPERO
coiled coil region 1403 1512 N/A INTRINSIC
coiled coil region 1539 1582 N/A INTRINSIC
low complexity region 1590 1604 N/A INTRINSIC
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Crocc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Crocc2 APN 1 93217044 nonsense probably null
R0396:Crocc2 UTSW 1 93224214 splice site probably benign
R1382:Crocc2 UTSW 1 93217093 critical splice donor site probably null
R4608:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4609:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4619:Crocc2 UTSW 1 93213650 missense probably benign
R4646:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4647:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4648:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4767:Crocc2 UTSW 1 93202856 missense possibly damaging 0.72
R4811:Crocc2 UTSW 1 93205896 missense probably damaging 0.99
R5046:Crocc2 UTSW 1 93205902 missense probably damaging 0.96
R5389:Crocc2 UTSW 1 93215641 missense probably benign 0.03
R5632:Crocc2 UTSW 1 93217853 missense probably damaging 0.98
R5887:Crocc2 UTSW 1 93194116 missense possibly damaging 0.47
R6128:Crocc2 UTSW 1 93194401 missense probably benign 0.28
R6142:Crocc2 UTSW 1 93190479 missense possibly damaging 0.61
R6258:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6260:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6312:Crocc2 UTSW 1 93215710 nonsense probably null
R6335:Crocc2 UTSW 1 93202838 missense probably benign 0.02
R6339:Crocc2 UTSW 1 93214032 missense probably benign 0.23
R6371:Crocc2 UTSW 1 93215631 missense probably benign 0.10
R6439:Crocc2 UTSW 1 93183404 missense possibly damaging 0.81
R6442:Crocc2 UTSW 1 93185053 missense probably benign 0.38
R6545:Crocc2 UTSW 1 93212937 missense probably benign 0.45
R6619:Crocc2 UTSW 1 93190501 missense probably benign 0.09
R6898:Crocc2 UTSW 1 93215582 missense probably benign 0.06
R7170:Crocc2 UTSW 1 93193982 missense possibly damaging 0.95
R7378:Crocc2 UTSW 1 93194087 missense probably damaging 0.98
R7395:Crocc2 UTSW 1 93216107 nonsense probably null
R7461:Crocc2 UTSW 1 93194589 missense possibly damaging 0.47
R7613:Crocc2 UTSW 1 93194589 missense possibly damaging 0.47
R7831:Crocc2 UTSW 1 93215473 missense probably benign 0.17
R7914:Crocc2 UTSW 1 93215473 missense probably benign 0.17
Z1177:Crocc2 UTSW 1 93213595 missense probably damaging 1.00
Z1177:Crocc2 UTSW 1 93226692 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGAAGCAGGGACATTAGGATC -3'
(R):5'- GGAGGTACAATCAGCAATAGCC -3'

Sequencing Primer
(F):5'- CAGGGACATTAGGATCTCCATGTC -3'
(R):5'- CCCGGCAGGATGTGTGATTAC -3'
Posted On2018-04-02