Incidental Mutation 'R6288:Rbm8a2'
ID509225
Institutional Source Beutler Lab
Gene Symbol Rbm8a2
Ensembl Gene ENSMUSG00000078184
Gene NameRNA binding motif protein 8A2
SynonymsY14, B020018G12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location175977777-175979114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 175978545 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 122 (E122G)
Ref Sequence ENSEMBL: ENSMUSP00000100599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000104983] [ENSMUST00000111167] [ENSMUST00000125404]
Predicted Effect probably benign
Transcript: ENSMUST00000065967
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104983
AA Change: E122G

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100599
Gene: ENSMUSG00000078184
AA Change: E122G

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
RRM 74 147 8.44e-22 SMART
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111167
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Rbm8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Rbm8a2 APN 1 175978662 missense possibly damaging 0.95
IGL02397:Rbm8a2 APN 1 175978638 missense probably damaging 1.00
R2202:Rbm8a2 UTSW 1 175978854 missense possibly damaging 0.89
R4815:Rbm8a2 UTSW 1 175978458 missense probably damaging 0.96
R5356:Rbm8a2 UTSW 1 175978689 missense possibly damaging 0.91
R6029:Rbm8a2 UTSW 1 175978746 missense probably benign 0.16
R6305:Rbm8a2 UTSW 1 175978746 missense probably benign 0.16
R7899:Rbm8a2 UTSW 1 175978641 missense probably benign 0.08
R8332:Rbm8a2 UTSW 1 175978401 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGCCCTGTTTAATCCAAGGC -3'
(R):5'- CAGCGCTCTGTTGAAGGTTG -3'

Sequencing Primer
(F):5'- TGGACTTGTAGAGAGACCACCC -3'
(R):5'- GGATTCTCTTTGTCACTGGAGTCC -3'
Posted On2018-04-02