Incidental Mutation 'R6288:Fam151a'
ID509227
Institutional Source Beutler Lab
Gene Symbol Fam151a
Ensembl Gene ENSMUSG00000034871
Gene Namefamily with sequence simliarity 151, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106733889-106748292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106748144 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 568 (T568P)
Ref Sequence ENSEMBL: ENSMUSP00000047860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047620] [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541]
Predicted Effect probably damaging
Transcript: ENSMUST00000047620
AA Change: T568P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047860
Gene: ENSMUSG00000034871
AA Change: T568P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:DUF2181 70 310 2.9e-107 PFAM
Pfam:DUF2181 342 579 8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065253
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102762
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Meta Mutation Damage Score 0.2987 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Fam151a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam151a APN 4 106747593 missense possibly damaging 0.56
IGL02095:Fam151a APN 4 106747875 missense probably damaging 1.00
IGL02170:Fam151a APN 4 106735598 critical splice donor site probably null
IGL02725:Fam151a APN 4 106748014 missense probably damaging 0.99
R0025:Fam151a UTSW 4 106748174 missense probably benign 0.16
R0114:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R0620:Fam151a UTSW 4 106747931 missense probably benign 0.06
R1345:Fam151a UTSW 4 106742294 missense probably damaging 0.99
R1482:Fam151a UTSW 4 106745679 missense probably damaging 1.00
R1965:Fam151a UTSW 4 106733915 unclassified probably benign
R2086:Fam151a UTSW 4 106735563 splice site probably null
R4078:Fam151a UTSW 4 106747757 missense probably benign 0.31
R4677:Fam151a UTSW 4 106748259 missense possibly damaging 0.72
R6110:Fam151a UTSW 4 106748198 missense probably damaging 0.98
R6188:Fam151a UTSW 4 106745499 missense possibly damaging 0.61
R6526:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R7298:Fam151a UTSW 4 106735528 missense possibly damaging 0.80
R7341:Fam151a UTSW 4 106735510 missense probably benign 0.00
R7363:Fam151a UTSW 4 106745484 missense probably damaging 1.00
R7573:Fam151a UTSW 4 106743305 missense probably damaging 1.00
R8368:Fam151a UTSW 4 106746993 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTTATCAGGAGCAGATGGTC -3'
(R):5'- TCTAGACACCACCCATGCTG -3'

Sequencing Primer
(F):5'- CAGATATGCTGGAGCTGTGTCAG -3'
(R):5'- TGCCCCAGGTCTTACACAGTG -3'
Posted On2018-04-02