Incidental Mutation 'R6288:Fbln2'
ID509231
Institutional Source Beutler Lab
Gene Symbol Fbln2
Ensembl Gene ENSMUSG00000064080
Gene Namefibulin 2
Synonyms5730577E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6288 (G1)
Quality Score222.009
Status Validated
Chromosome6
Chromosomal Location91212455-91272540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91233281 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 69 (Y69F)
Ref Sequence ENSEMBL: ENSMUSP00000116302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041544] [ENSMUST00000113498] [ENSMUST00000132021] [ENSMUST00000134974] [ENSMUST00000153364]
Predicted Effect probably damaging
Transcript: ENSMUST00000041544
AA Change: Y69F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048334
Gene: ENSMUSG00000064080
AA Change: Y69F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF 712 755 1.33e1 SMART
EGF_CA 756 800 1.34e-6 SMART
EGF_CA 801 846 1.65e-6 SMART
EGF_CA 847 894 2.06e-7 SMART
EGF_CA 895 937 3.56e-11 SMART
EGF_CA 938 979 3.48e-14 SMART
EGF_CA 980 1018 1.7e-8 SMART
EGF_CA 1019 1061 8.18e-11 SMART
EGF_CA 1062 1106 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113498
AA Change: Y69F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109126
Gene: ENSMUSG00000064080
AA Change: Y69F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF_CA 709 753 1.34e-6 SMART
EGF_CA 754 799 1.65e-6 SMART
EGF_CA 800 847 2.06e-7 SMART
EGF_CA 848 890 3.56e-11 SMART
EGF_CA 891 932 3.48e-14 SMART
EGF_CA 933 971 1.7e-8 SMART
EGF_CA 972 1014 8.18e-11 SMART
EGF_CA 1015 1059 5.08e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132021
AA Change: Y69F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116456
Gene: ENSMUSG00000064080
AA Change: Y69F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134974
AA Change: Y69F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116302
Gene: ENSMUSG00000064080
AA Change: Y69F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153364
Meta Mutation Damage Score 0.2080 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein, which belongs to the fibulin family. This protein binds various extracellular ligands and calcium. It may play a role during organ development, in particular, during the differentiation of heart, skeletal and neuronal structures. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alle are viable, fertile and grossly normal with no apparent defects in elastic fiber formation in the aorta and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Fbln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Fbln2 APN 6 91266392 missense probably damaging 1.00
IGL01664:Fbln2 APN 6 91233457 missense probably damaging 0.96
IGL02110:Fbln2 APN 6 91234102 missense probably benign 0.01
IGL02227:Fbln2 APN 6 91256367 missense possibly damaging 0.90
IGL02814:Fbln2 APN 6 91265857 nonsense probably null
IGL03287:Fbln2 APN 6 91233494 missense probably damaging 1.00
IGL03412:Fbln2 APN 6 91271781 missense probably damaging 1.00
IGL03014:Fbln2 UTSW 6 91265919 intron probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R1563:Fbln2 UTSW 6 91263383 nonsense probably null
R1843:Fbln2 UTSW 6 91265775 missense probably damaging 1.00
R1846:Fbln2 UTSW 6 91256417 missense possibly damaging 0.91
R1994:Fbln2 UTSW 6 91234301 missense probably damaging 1.00
R2431:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R2443:Fbln2 UTSW 6 91259711 missense probably damaging 1.00
R2925:Fbln2 UTSW 6 91265855 missense probably damaging 1.00
R3030:Fbln2 UTSW 6 91233715 missense probably damaging 1.00
R3758:Fbln2 UTSW 6 91256381 missense probably damaging 1.00
R3854:Fbln2 UTSW 6 91266371 missense probably damaging 1.00
R4006:Fbln2 UTSW 6 91269961 splice site probably null
R4627:Fbln2 UTSW 6 91259767 missense probably damaging 1.00
R4752:Fbln2 UTSW 6 91256243 missense probably benign
R4763:Fbln2 UTSW 6 91270000 missense probably damaging 1.00
R4798:Fbln2 UTSW 6 91269186 missense probably benign 0.03
R4877:Fbln2 UTSW 6 91233495 missense probably damaging 1.00
R4878:Fbln2 UTSW 6 91256995 critical splice donor site probably null
R4937:Fbln2 UTSW 6 91264699 missense probably damaging 0.99
R4969:Fbln2 UTSW 6 91271587 missense possibly damaging 0.64
R4996:Fbln2 UTSW 6 91266010 missense probably benign 0.05
R5344:Fbln2 UTSW 6 91266383 missense probably damaging 1.00
R5681:Fbln2 UTSW 6 91271796 missense probably damaging 1.00
R5838:Fbln2 UTSW 6 91271848 missense possibly damaging 0.55
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6433:Fbln2 UTSW 6 91233272 missense probably damaging 1.00
R6451:Fbln2 UTSW 6 91234259 missense probably benign 0.18
R6491:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6520:Fbln2 UTSW 6 91259659 missense probably damaging 1.00
R6657:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6987:Fbln2 UTSW 6 91234229 missense probably benign 0.00
R7344:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R7485:Fbln2 UTSW 6 91270161 splice site probably null
R7488:Fbln2 UTSW 6 91265863 critical splice donor site probably null
R7571:Fbln2 UTSW 6 91268575 missense probably damaging 1.00
R7667:Fbln2 UTSW 6 91233667 missense probably damaging 1.00
R7776:Fbln2 UTSW 6 91269199 missense probably damaging 1.00
R7779:Fbln2 UTSW 6 91233194 missense probably damaging 1.00
R8320:Fbln2 UTSW 6 91257767 missense possibly damaging 0.51
Z1088:Fbln2 UTSW 6 91233346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGGGACTCCTGAGACATG -3'
(R):5'- CTGTCGGCTACTACTACAGC -3'

Sequencing Primer
(F):5'- TGAGACATGCTGCTCCAGGAATC -3'
(R):5'- CTACTACAGCTTCAATGCAGTTGGG -3'
Posted On2018-04-02