Incidental Mutation 'R6288:4931406B18Rik'
ID509232
Institutional Source Beutler Lab
Gene Symbol 4931406B18Rik
Ensembl Gene ENSMUSG00000013353
Gene NameRIKEN cDNA 4931406B18 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43492044-43505940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43498125 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 274 (E274V)
Ref Sequence ENSEMBL: ENSMUSP00000139468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013497] [ENSMUST00000163474] [ENSMUST00000163619] [ENSMUST00000168213] [ENSMUST00000168883] [ENSMUST00000171174] [ENSMUST00000191516]
Predicted Effect probably damaging
Transcript: ENSMUST00000013497
AA Change: E274V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013497
Gene: ENSMUSG00000013353
AA Change: E274V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:2ZG3|A 24 185 9e-7 PDB
Blast:IG_like 119 185 3e-19 BLAST
low complexity region 186 205 N/A INTRINSIC
SCOP:d1iray3 219 297 6e-3 SMART
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163474
AA Change: E180V

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126619
Gene: ENSMUSG00000013353
AA Change: E180V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 111 3e-12 BLAST
SCOP:d1he7a_ 111 203 1e-3 SMART
Blast:IG_like 125 194 1e-5 BLAST
transmembrane domain 217 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163619
SMART Domains Protein: ENSMUSP00000131071
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:2ZG3|A 17 88 1e-5 PDB
Blast:IG_like 22 88 2e-21 BLAST
low complexity region 89 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168213
SMART Domains Protein: ENSMUSP00000129928
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 119 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168636
Predicted Effect probably benign
Transcript: ENSMUST00000168883
Predicted Effect probably damaging
Transcript: ENSMUST00000171174
AA Change: E274V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129888
Gene: ENSMUSG00000013353
AA Change: E274V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191516
AA Change: E274V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139468
Gene: ENSMUSG00000013353
AA Change: E274V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in 4931406B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:4931406B18Rik APN 7 43504175 splice site probably benign
IGL01902:4931406B18Rik APN 7 43497843 missense probably damaging 0.96
IGL02616:4931406B18Rik APN 7 43501013 splice site probably null
IGL02677:4931406B18Rik APN 7 43501095 nonsense probably null
IGL03030:4931406B18Rik APN 7 43495633 missense possibly damaging 0.62
R0007:4931406B18Rik UTSW 7 43498042 splice site probably benign
R0788:4931406B18Rik UTSW 7 43499199 missense probably damaging 0.98
R1544:4931406B18Rik UTSW 7 43498119 missense possibly damaging 0.92
R2995:4931406B18Rik UTSW 7 43499368 missense probably damaging 1.00
R4656:4931406B18Rik UTSW 7 43501141 missense probably benign 0.20
R5595:4931406B18Rik UTSW 7 43497872 missense possibly damaging 0.92
R6389:4931406B18Rik UTSW 7 43497830 missense possibly damaging 0.94
R6651:4931406B18Rik UTSW 7 43498072 missense possibly damaging 0.81
R6912:4931406B18Rik UTSW 7 43501147 missense possibly damaging 0.95
R7254:4931406B18Rik UTSW 7 43498199 missense probably damaging 0.99
R7615:4931406B18Rik UTSW 7 43497849 missense possibly damaging 0.64
R8167:4931406B18Rik UTSW 7 43497864 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACGAGAACATGGTCACCCTG -3'
(R):5'- ACCAGGCTGCTCAACTACTC -3'

Sequencing Primer
(F):5'- AACATGGTCACCCTGAGGCTTC -3'
(R):5'- CTGTTTGCTGAAGAGGACACTCAC -3'
Posted On2018-04-02