Incidental Mutation 'R6288:Olfr597'
ID509234
Institutional Source Beutler Lab
Gene Symbol Olfr597
Ensembl Gene ENSMUSG00000073952
Gene Nameolfactory receptor 597
SynonymsGA_x6K02T2PBJ9-6029614-6030561, MOR23-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103316315-103322799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103321079 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 223 (I223V)
Ref Sequence ENSEMBL: ENSMUSP00000150238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098203] [ENSMUST00000214765] [ENSMUST00000216456]
Predicted Effect probably damaging
Transcript: ENSMUST00000098203
AA Change: I223V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095804
Gene: ENSMUSG00000073952
AA Change: I223V

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 2.2e-89 PFAM
Pfam:7TM_GPCR_Srsx 41 312 5.7e-7 PFAM
Pfam:7tm_1 47 297 3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214765
Predicted Effect probably damaging
Transcript: ENSMUST00000216456
AA Change: I223V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.1886 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Olfr597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Olfr597 APN 7 103321334 missense probably benign 0.27
IGL01872:Olfr597 APN 7 103320972 missense probably benign 0.17
IGL02797:Olfr597 APN 7 103320851 missense probably benign
IGL02811:Olfr597 APN 7 103320933 missense probably benign
PIT4131001:Olfr597 UTSW 7 103320869 nonsense probably null
R1800:Olfr597 UTSW 7 103320414 start codon destroyed probably null 0.98
R4921:Olfr597 UTSW 7 103320543 missense probably damaging 1.00
R6993:Olfr597 UTSW 7 103320791 unclassified probably benign
R7043:Olfr597 UTSW 7 103321085 unclassified probably benign
R7322:Olfr597 UTSW 7 103321287 missense
R7472:Olfr597 UTSW 7 103320449 missense
R7704:Olfr597 UTSW 7 103320771 missense
R8393:Olfr597 UTSW 7 103320461 missense
R8418:Olfr597 UTSW 7 103321071 missense
Predicted Primers PCR Primer
(F):5'- CGGTAGTACTTGTAGGCCTG -3'
(R):5'- CCCGCTTTCGAATGACCATG -3'

Sequencing Primer
(F):5'- CGGTAGTACTTGTAGGCCTGTTACC -3'
(R):5'- CTCCATACACAATAGGGTTGAGAGC -3'
Posted On2018-04-02