Incidental Mutation 'R6288:4930438A08Rik'
ID509240
Institutional Source Beutler Lab
Gene Symbol 4930438A08Rik
Ensembl Gene ENSMUSG00000069873
Gene NameRIKEN cDNA 4930438A08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58274799-58294289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58293595 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 380 (D380Y)
Ref Sequence ENSEMBL: ENSMUSP00000104462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108834] [ENSMUST00000208022]
Predicted Effect probably damaging
Transcript: ENSMUST00000108834
AA Change: D380Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104462
Gene: ENSMUSG00000069873
AA Change: D380Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pyr_redox_2 29 166 2e-8 PFAM
Pfam:AlaDh_PNT_C 48 124 8.8e-8 PFAM
Pfam:FAD_binding_3 61 98 1.9e-7 PFAM
Pfam:HI0933_like 62 103 3.1e-8 PFAM
Pfam:Pyr_redox 63 105 1.8e-7 PFAM
Pfam:FAD_binding_2 63 119 8.7e-9 PFAM
Pfam:DAO 63 212 2.9e-8 PFAM
Pfam:NAD_binding_8 66 133 7.1e-15 PFAM
Pfam:Amino_oxidase 71 270 7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208022
Meta Mutation Damage Score 0.8730 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in 4930438A08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02884:4930438A08Rik APN 11 58287476 missense probably benign 0.01
IGL03088:4930438A08Rik APN 11 58293384 missense unknown
R0715:4930438A08Rik UTSW 11 58288350 missense probably damaging 1.00
R1139:4930438A08Rik UTSW 11 58288286 missense probably damaging 1.00
R1833:4930438A08Rik UTSW 11 58288388 nonsense probably null
R5906:4930438A08Rik UTSW 11 58291434 splice site probably null
R6056:4930438A08Rik UTSW 11 58293638 missense probably damaging 0.96
R6981:4930438A08Rik UTSW 11 58293718 unclassified probably benign
R6989:4930438A08Rik UTSW 11 58287402 missense possibly damaging 0.88
R7195:4930438A08Rik UTSW 11 58288416 critical splice donor site probably null
R7344:4930438A08Rik UTSW 11 58291447 missense
R7651:4930438A08Rik UTSW 11 58293362 missense
R8141:4930438A08Rik UTSW 11 58286585 missense
R8187:4930438A08Rik UTSW 11 58289722 missense
R8214:4930438A08Rik UTSW 11 58286621 missense
R8228:4930438A08Rik UTSW 11 58291555 missense
Predicted Primers PCR Primer
(F):5'- GCTACCACTGCTAAAGCTGC -3'
(R):5'- AAGGGTCTTGACTCCAGTTCTTG -3'

Sequencing Primer
(F):5'- TGCTAAAGCTGCCCGCCTC -3'
(R):5'- CCAGTTCTTGATTGCAGAGTAAGGAC -3'
Posted On2018-04-02