Incidental Mutation 'R6288:Sox11'
ID509242
Institutional Source Beutler Lab
Gene Symbol Sox11
Ensembl Gene ENSMUSG00000063632
Gene NameSRY (sex determining region Y)-box 11
Synonyms6230403H02Rik, 1110038H03Rik, end1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location27334264-27342574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27342333 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 26 (F26L)
Ref Sequence ENSEMBL: ENSMUSP00000078070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079063]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079063
AA Change: F26L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078070
Gene: ENSMUSG00000063632
AA Change: F26L

DomainStartEndE-ValueType
HMG 48 118 1.35e-27 SMART
low complexity region 142 174 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
low complexity region 207 213 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 281 309 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may function in the developing nervous system and play a role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired ossification and impaired development of the heart, lung, spleen, stomach, skeleton and pancreas. Mice homozygous for a different knock-out allele exhibit abnormal nervous system development and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Sox11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0898:Sox11 UTSW 12 27341225 missense probably damaging 1.00
R1265:Sox11 UTSW 12 27341736 missense probably benign 0.03
R2073:Sox11 UTSW 12 27342279 missense possibly damaging 0.91
R2108:Sox11 UTSW 12 27341703 missense probably damaging 1.00
R3620:Sox11 UTSW 12 27341736 missense probably benign 0.03
R3855:Sox11 UTSW 12 27341502 missense probably damaging 0.99
R5681:Sox11 UTSW 12 27341824 missense probably benign
R6933:Sox11 UTSW 12 27341494 missense probably damaging 0.99
R7752:Sox11 UTSW 12 27341440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGATAATCAGCCATGTGC -3'
(R):5'- AGGACTTTGCAACTTGCCG -3'

Sequencing Primer
(F):5'- AGCATCTTCCAGCGCTTG -3'
(R):5'- CTTTGCAACTTGCCGGAGAAG -3'
Posted On2018-04-02