Incidental Mutation 'R6288:Ighv1-20'
ID509243
Institutional Source Beutler Lab
Gene Symbol Ighv1-20
Ensembl Gene ENSMUSG00000095761
Gene Nameimmunoglobulin heavy variable V1-20
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location114723772-114724205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114723899 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 75 (G75D)
Ref Sequence ENSEMBL: ENSMUSP00000141859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103506] [ENSMUST00000194968]
Predicted Effect probably benign
Transcript: ENSMUST00000103506
AA Change: G74D

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100287
Gene: ENSMUSG00000095761
AA Change: G74D

DomainStartEndE-ValueType
IGv 35 116 1.42e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194968
AA Change: G75D

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141859
Gene: ENSMUSG00000095761
AA Change: G75D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 5.7e-29 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Ighv1-20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02320:Ighv1-20 APN 12 114723843 missense probably damaging 1.00
R2427:Ighv1-20 UTSW 12 114724072 synonymous silent
R4274:Ighv1-20 UTSW 12 114724199 missense probably damaging 1.00
R5472:Ighv1-20 UTSW 12 114723851 missense probably damaging 0.97
R5778:Ighv1-20 UTSW 12 114723877 missense probably benign 0.11
R7318:Ighv1-20 UTSW 12 114724190 missense possibly damaging 0.93
R8063:Ighv1-20 UTSW 12 114723785 missense probably damaging 1.00
R8343:Ighv1-20 UTSW 12 114724190 missense probably benign 0.00
R8381:Ighv1-20 UTSW 12 114723881 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCAAATCTACAAGTGACACTTCTC -3'
(R):5'- TTCTCTGAGGTTCAGCTGCAG -3'

Sequencing Primer
(F):5'- AAGTCTTGTCAGTCCCAAGG -3'
(R):5'- TTCAGCTGCAGCAGTCTG -3'
Posted On2018-04-02