Incidental Mutation 'R6288:Cts7'
ID509245
Institutional Source Beutler Lab
Gene Symbol Cts7
Ensembl Gene ENSMUSG00000021440
Gene Namecathepsin 7
SynonymsEpcs24, Epcs71, CTS1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location61352461-61358197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61352770 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 321 (G321E)
Ref Sequence ENSEMBL: ENSMUSP00000153603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021892] [ENSMUST00000224773] [ENSMUST00000224986] [ENSMUST00000225321]
Predicted Effect probably damaging
Transcript: ENSMUST00000021892
AA Change: G321E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021892
Gene: ENSMUSG00000021440
AA Change: G321E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 2.02e-15 SMART
Pept_C1 112 330 6.25e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224773
Predicted Effect probably damaging
Transcript: ENSMUST00000224986
AA Change: G321E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225321
Meta Mutation Damage Score 0.9295 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Cts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Cts7 APN 13 61356909 critical splice donor site probably null
IGL01954:Cts7 APN 13 61352823 missense probably benign 0.06
IGL01973:Cts7 APN 13 61355600 missense probably benign 0.02
IGL02098:Cts7 APN 13 61356529 missense probably damaging 1.00
IGL02716:Cts7 APN 13 61356608 missense probably benign 0.01
IGL02903:Cts7 APN 13 61356626 splice site probably benign
IGL03351:Cts7 APN 13 61356603 missense probably damaging 1.00
PIT4305001:Cts7 UTSW 13 61356572 missense probably damaging 1.00
R0691:Cts7 UTSW 13 61355734 missense probably damaging 1.00
R1168:Cts7 UTSW 13 61353817 missense probably damaging 0.99
R1711:Cts7 UTSW 13 61352810 missense probably damaging 1.00
R2352:Cts7 UTSW 13 61352772 nonsense probably null
R2442:Cts7 UTSW 13 61355617 nonsense probably null
R3817:Cts7 UTSW 13 61356536 missense probably damaging 0.98
R5513:Cts7 UTSW 13 61355584 missense possibly damaging 0.70
R5870:Cts7 UTSW 13 61355731 missense probably damaging 0.99
R6286:Cts7 UTSW 13 61352770 missense probably damaging 1.00
R6479:Cts7 UTSW 13 61355641 missense probably benign 0.00
R6653:Cts7 UTSW 13 61355003 missense probably damaging 1.00
R6721:Cts7 UTSW 13 61356294 missense probably damaging 1.00
R7246:Cts7 UTSW 13 61355580 missense probably damaging 0.99
R7644:Cts7 UTSW 13 61356968 nonsense probably null
R7939:Cts7 UTSW 13 61356550 missense probably damaging 1.00
R8336:Cts7 UTSW 13 61356909 critical splice donor site probably null
Z1177:Cts7 UTSW 13 61355632 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GTCACTTCAGAACATCATCAATGG -3'
(R):5'- ACTCTGGTAGTTGGCCATCTG -3'

Sequencing Primer
(F):5'- TCAGAACATCATCAATGGTTATGAC -3'
(R):5'- CCATCTGGCTTTTCTGATGC -3'
Posted On2018-04-02