Incidental Mutation 'R6288:Cyp2d9'
ID509247
Institutional Source Beutler Lab
Gene Symbol Cyp2d9
Ensembl Gene ENSMUSG00000068086
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 9
SynonymsCyp2d, testosterone 16alpha-hydroxylase, P450-2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82433437-82456845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82456415 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 422 (H422Y)
Ref Sequence ENSEMBL: ENSMUSP00000086530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089129] [ENSMUST00000229313] [ENSMUST00000229473] [ENSMUST00000229793] [ENSMUST00000230000] [ENSMUST00000230024] [ENSMUST00000230191] [ENSMUST00000231136]
Predicted Effect probably damaging
Transcript: ENSMUST00000089129
AA Change: H422Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086530
Gene: ENSMUSG00000068086
AA Change: H422Y

DomainStartEndE-ValueType
Pfam:p450 37 497 1.7e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229181
Predicted Effect probably benign
Transcript: ENSMUST00000229313
Predicted Effect probably benign
Transcript: ENSMUST00000229473
Predicted Effect probably benign
Transcript: ENSMUST00000229793
Predicted Effect possibly damaging
Transcript: ENSMUST00000230000
AA Change: H189Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect silent
Transcript: ENSMUST00000230024
Predicted Effect probably benign
Transcript: ENSMUST00000230191
Predicted Effect probably benign
Transcript: ENSMUST00000231136
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Slc38a1 A G 15: 96,586,878 V267A probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Cyp2d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cyp2d9 APN 15 82455094 missense probably benign 0.05
IGL00587:Cyp2d9 APN 15 82455143 missense possibly damaging 0.89
IGL00815:Cyp2d9 APN 15 82456375 missense possibly damaging 0.94
IGL03023:Cyp2d9 APN 15 82455518 missense probably damaging 0.99
IGL03410:Cyp2d9 APN 15 82456699 missense probably benign 0.00
R0417:Cyp2d9 UTSW 15 82455951 missense probably damaging 1.00
R0627:Cyp2d9 UTSW 15 82455790 missense probably damaging 1.00
R1326:Cyp2d9 UTSW 15 82455156 missense possibly damaging 0.50
R1501:Cyp2d9 UTSW 15 82454324 nonsense probably null
R1893:Cyp2d9 UTSW 15 82452606 missense probably damaging 0.97
R2496:Cyp2d9 UTSW 15 82452479 missense probably damaging 1.00
R2519:Cyp2d9 UTSW 15 82454518 splice site probably null
R3155:Cyp2d9 UTSW 15 82452642 critical splice donor site probably null
R4691:Cyp2d9 UTSW 15 82455832 missense probably damaging 1.00
R4727:Cyp2d9 UTSW 15 82454401 start codon destroyed probably null 0.99
R4770:Cyp2d9 UTSW 15 82452573 missense probably damaging 0.98
R5319:Cyp2d9 UTSW 15 82454055 missense probably damaging 1.00
R5486:Cyp2d9 UTSW 15 82452578 missense probably damaging 0.96
R5516:Cyp2d9 UTSW 15 82454327 missense probably null 1.00
R5646:Cyp2d9 UTSW 15 82452464 missense probably benign 0.01
R5898:Cyp2d9 UTSW 15 82455524 missense probably benign 0.02
R6193:Cyp2d9 UTSW 15 82452527 missense probably benign 0.01
R6924:Cyp2d9 UTSW 15 82455212 missense probably damaging 1.00
R7524:Cyp2d9 UTSW 15 82455945 missense probably damaging 1.00
R7525:Cyp2d9 UTSW 15 82454092 missense possibly damaging 0.91
R7731:Cyp2d9 UTSW 15 82455432 critical splice acceptor site probably null
R7889:Cyp2d9 UTSW 15 82455826 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAGGATCCAGTGTGTGCAG -3'
(R):5'- CCATAGACTCCAGAGTTGCTG -3'

Sequencing Primer
(F):5'- TCCAGTGTGTGCAGGAAAG -3'
(R):5'- TCCCCCAGGCATGATCTG -3'
Posted On2018-04-02