Incidental Mutation 'R6288:Slc38a1'
ID509249
Institutional Source Beutler Lab
Gene Symbol Slc38a1
Ensembl Gene ENSMUSG00000023169
Gene Namesolute carrier family 38, member 1
SynonymsNAT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6288 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location96571418-96642913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96586878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000097833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088452] [ENSMUST00000088454] [ENSMUST00000100262]
Predicted Effect probably benign
Transcript: ENSMUST00000088452
AA Change: V267A

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085799
Gene: ENSMUSG00000023169
AA Change: V267A

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 6.1e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088454
AA Change: V267A

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085801
Gene: ENSMUSG00000023169
AA Change: V267A

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100262
AA Change: V267A

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097833
Gene: ENSMUSG00000023169
AA Change: V267A

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230756
Meta Mutation Damage Score 0.1809 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,293,595 D380Y probably damaging Het
4931406B18Rik T A 7: 43,498,125 E274V probably damaging Het
Ankrd44 A G 1: 54,763,763 L192P probably damaging Het
Apbb1 T A 7: 105,559,227 I624F probably damaging Het
Asxl2 A G 12: 3,476,040 K219E possibly damaging Het
Bean1 T A 8: 104,210,990 L33Q probably damaging Het
Col22a1 T C 15: 71,894,869 probably null Het
Col6a4 T C 9: 106,068,263 D884G probably damaging Het
Crocc2 A G 1: 93,194,505 R707G probably benign Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp2d9 C T 15: 82,456,415 H422Y probably damaging Het
Epha2 C T 4: 141,317,033 A382V probably benign Het
Fam151a A C 4: 106,748,144 T568P probably damaging Het
Fbln2 A T 6: 91,233,281 Y69F probably damaging Het
Flg2 A T 3: 93,203,785 H1040L unknown Het
Gm28710 T A 5: 16,856,285 C738S possibly damaging Het
Gucy2g T C 19: 55,227,513 T476A probably benign Het
Hist1h3f A G 13: 23,544,494 T4A probably benign Het
Ighv1-20 C T 12: 114,723,899 G75D probably benign Het
Inpp5b G A 4: 124,785,227 V476I probably benign Het
Nrxn2 T A 19: 6,490,561 L855Q probably damaging Het
Olfr1097 A G 2: 86,890,882 F98L probably benign Het
Olfr597 A G 7: 103,321,079 I223V probably damaging Het
Pcolce2 T A 9: 95,681,593 Y211N probably damaging Het
Phf21b A C 15: 84,855,071 probably benign Het
Rbm8a2 T C 1: 175,978,545 E122G probably benign Het
Rimbp3 C T 16: 17,212,908 P1399S probably benign Het
Sox11 A G 12: 27,342,333 F26L possibly damaging Het
Ssbp3 T A 4: 107,046,080 probably null Het
Trim12c C T 7: 104,346,729 V146I probably benign Het
Trrap C A 5: 144,811,992 T1543K probably damaging Het
Zfp473 C A 7: 44,733,534 K457N probably damaging Het
Other mutations in Slc38a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc38a1 APN 15 96585623 missense possibly damaging 0.89
IGL01376:Slc38a1 APN 15 96585556 missense probably damaging 1.00
IGL01920:Slc38a1 APN 15 96586897 missense probably benign
IGL01993:Slc38a1 APN 15 96624046 missense probably damaging 1.00
IGL02201:Slc38a1 APN 15 96578798 missense probably damaging 1.00
IGL03074:Slc38a1 APN 15 96592524 missense possibly damaging 0.72
IGL03370:Slc38a1 APN 15 96579347 missense possibly damaging 0.93
R0918:Slc38a1 UTSW 15 96609862 missense probably damaging 1.00
R1506:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R1510:Slc38a1 UTSW 15 96609860 missense probably damaging 1.00
R1713:Slc38a1 UTSW 15 96578760 missense probably damaging 1.00
R1721:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R1867:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R4254:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4255:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4754:Slc38a1 UTSW 15 96576782 missense probably damaging 0.98
R5548:Slc38a1 UTSW 15 96590474 missense probably damaging 1.00
R5610:Slc38a1 UTSW 15 96616141 critical splice donor site probably null
R6235:Slc38a1 UTSW 15 96578792 missense probably benign 0.36
R7904:Slc38a1 UTSW 15 96624040 missense possibly damaging 0.95
R8195:Slc38a1 UTSW 15 96592566 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CCTGGAGGGATTGTTACGAG -3'
(R):5'- GTTCTGACATTGTCGGAGGC -3'

Sequencing Primer
(F):5'- CTGGAGGGATTGTTACGAGAATGC -3'
(R):5'- ACATTGTCGGAGGCCCTGG -3'
Posted On2018-04-02